SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


55.51 kDa
protein length
508 aa Sequence Blast
gene length
1527 bp Sequence Blast
histidine utilization

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of histidine]
  • Gene

    4,042,051 → 4,043,577

    The protein

    Catalyzed reaction/ biological activity

  • L-histidine --> NH4+ + trans-urocanate (according to Swiss-Prot)
  • Protein family

  • PAL/histidase family (single member, according to UniProt)
  • Structure

  • [PDB|1B8F] (from ''Pseudomonas putida'', 43% identity, 62% similarity) [Pubmed|10220322]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8071225], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|8071225], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|8682780], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|HutP]: antitermination, at a protein-dependent [SW|RNA switch] located between [gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP] and [gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH] [Pubmed|8071225], in [regulon|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|HutP regulon]
  • regulation

  • induced by histidine ([protein|search|HutP]) [Pubmed|8071225]
  • view in new tab

    Biological materials


  • GP1114 (hutH::Tn10, spc), available in [SW|Stülke] lab
  • BKE39350 (Δ[gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGCCCAACTCCTTTTT, downstream forward: _UP4_AAAGAACTAAGGGGGATGAA
  • BKK39350 (Δ[gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGCCCAACTCCTTTTT, downstream forward: _UP4_AAAGAACTAAGGGGGATGAA
  • References


  • 22933560
  • Original publications

  • 10746760,6143742,8071225,8682780,10217782