SubtiBank SubtiBank
sepF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sepF

part of the [SW|divisome], recruits [protein|search|FtsZ ]to the membrane
locus
BSU_15390
pI
4.86
mw
17.01 kDa
protein length
149 aa Sequence Blast
gene length
450 bp Sequence Blast
function
recruitment of [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ]
product
[protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ]-interacting protein, member of the [SW|divisome]
essential
no
synonyms
ylmF

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.2|Other genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,610,865 → 1,611,314

    Phenotypes of a mutant

  • perturbation of the formation of properly formed division septa
  • less efficient cell division results in longer cells. Electron microscopy reveals strongly distorted division septa.
  • the ''[gene|DB09F1C36257F511A84A083967A25A9D46744D14|sepF]'' mutation in combination with a constitutively active form of [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR] ([protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]-R204C) results in the formation of cell wall-less L-forms [Pubmed|22122227]
  • the ''sepF'' mutation is synthetically lethal in combination with an ''[gene|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA]'' mutation or an ''[gene|672EA84D7725BE21F649DF30A11EB4E0EDFC3925|ftsA]'' mutation [Pubmed|24218584]
  • The protein

    Catalyzed reaction/ biological activity

  • SepF assembles into very large (∼50 nm diameter) rings. These rings are able to bundle [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ] protofilaments into strikingly long and regular tubular structures reminiscent of eukaryotic microtubules [Pubmed|21224850]
  • SepF anchors [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ] bundles to the membrane [Pubmed|24218584]
  • Protein family

  • sepF family (single member, according to UniProt)
  • [SW|Domains]

  • N-terminal amphipatic helix for membrane binding [Pubmed|24218584]
  • C-terminal globular [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ]-binding domain [Pubmed|24218584]
  • Structure

  • [PDB|3ZIH] (the [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ]-binding C-terminal domain) [Pubmed|24218584]
  • [SW|Localization]

  • septum [Pubmed|16420366]
  • membrane [Pubmed|24218584]
  • Expression and Regulation

    Operons

    genes
    [gene|ECCE99438DBFC52DA7236CB4F6486DD004CADF73|ylmD]-[gene|31789A170CB624BF8210C915F40007F802F5C81B|ylmE]-[gene|DB09F1C36257F511A84A083967A25A9D46744D14|sepF]-[gene|2B2D285D5A8F160808A21DCF07BDB924365970C5|ylmG]-[gene|BD5ACF930DD63E258D71569326752C9A1D7B9324|ylmH]
    description
    [Pubmed|16420366]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B172 (ylmF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1171 NBRP B. subtilis, Japan]
  • GP2008 (''[gene|DB09F1C36257F511A84A083967A25A9D46744D14|sepF]''::''spc''), available in [SW|Jörg Stülke]'s lab
  • BKE15390 (Δ[gene|DB09F1C36257F511A84A083967A25A9D46744D14|sepF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTCATTGCTGTACACC, downstream forward: _UP4_GAACATCAGAGGTGGTAAAG
  • BKK15390 (Δ[gene|DB09F1C36257F511A84A083967A25A9D46744D14|sepF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTCATTGCTGTACACC, downstream forward: _UP4_GAACATCAGAGGTGGTAAAG
  • labs

  • [SW|Leendert Hamoen], CBCB, Newcastle University, UK
  • [SW|Shu Ishikawa], Nara Institute of Science and Technology, Nara, Japan
  • References

    Reviews

  • 19680248,22126136,29355854
  • Original Publications

  • 16420366,16796675,14651647,24218584,22912848,21224850,22122227,29209072