SubtiBank SubtiBank
yhcR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhcR

extracellular non-specific endonuclease, Rnase
locus
BSU09190
pI
4.69
mw
132.47 kDa
protein length
1217 aa Sequence Blast
gene length
3654 bp Sequence Blast
function
utilization of nucleic acids
product
extracellular non-specific endonuclease, Rnase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.5|Biosynthesis/ acquisition of nucleotides/ other]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.2|Endoribonucleases]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    991,348 → 995,001

    The protein

    Protein family

  • 5'-nucleotidase family (with [protein|B791B0603042603CB5B5E03CA129B20D02BC02BC|YfkN], according to UniProt)
  • Paralogous protein(s)

  • [protein|B791B0603042603CB5B5E03CA129B20D02BC02BC|YfkN]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862], attached to the cell wall [Pubmed|21800427]
  • Expression and Regulation

    Operons

    genes
    [gene|DAFBC470DA0FA437B117716DE899A8D3EC454672|yhcR]-[gene|A24243129860F1B043EBE1358FAEA57BED111BBC|yhcS]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A665 (yhcR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/665 NBRP B. subtilis, Japan]
  • BKE09190 (Δ[gene|DAFBC470DA0FA437B117716DE899A8D3EC454672|yhcR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAATTCCTTTCAGGCT, downstream forward: _UP4_AGAAAAAGGAGCGCCTCCAG
  • BKK09190 (Δ[gene|DAFBC470DA0FA437B117716DE899A8D3EC454672|yhcR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAATTCCTTTCAGGCT, downstream forward: _UP4_AGAAAAAGGAGCGCCTCCAG
  • labs

  • [SW|David Bechhofer], Mount Sinai School, New York, USA [http://www.mountsinai.org/Research/Centers%20Laboratories%20and%20Programs/Bechhofer%20Laboratory?citype=Physician&ciid=Bechhofer%20David%20H%201255565 Homepage]
  • References

  • 15292138,21800427,18957862