SubtiBank SubtiBank
rpmEB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rpmEB

general stress protein, binds in the stationary phase to the [SW|ribosome], replaces [protein|035154A4160F084BA1CC124D0951937B203E167D|RpmE] under conditions of zinc limitation
locus
BSU_30700
pI
9.81
mw
9.39 kDa
protein length
gene length
249 bp Sequence Blast
function
survival of salt stress
product
accessory ribosomal protein
essential
no
synonyms
rpmE2,ytiA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    3,138,978 → 3,139,226

    The protein

    Protein family

  • bacterial [SW|ribosomal protein] bL31 family (with [protein|035154A4160F084BA1CC124D0951937B203E167D|RpmE], according to UniProt)
  • Paralogous protein(s)

  • [protein|035154A4160F084BA1CC124D0951937B203E167D|RpmE]
  • Modification

  • phosphorylated on Arg-70 [Pubmed|22517742]
  • Structure

  • [PDB|5O5J] (30S ribosome subunit of Mycobacterium smegmatis, 43% identity) [pubmed|28683309]
  • Expression and Regulation

    Operons

    genes
    [gene|DAE7AB27A4C42BF50556BB76F33BEFA8DF35EA3A|rpmEB]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]: repression, in the presence of zinc [PubMed|12904577,15049826], in [regulon|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A292 (ytiA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/292 NBRP B. subtilis, Japan]
  • BKE30700 (Δ[gene|DAE7AB27A4C42BF50556BB76F33BEFA8DF35EA3A|rpmEB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGTATCTCCTTTCAAT, downstream forward: _UP4_TAAGGCAGGCCTGAGGGTTT
  • BKK30700 (Δ[gene|DAE7AB27A4C42BF50556BB76F33BEFA8DF35EA3A|rpmEB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGTATCTCCTTTCAAT, downstream forward: _UP4_TAAGGCAGGCCTGAGGGTTT
  • References

  • 17163968,15049826,16547061,12904577,22383849,15805528,19648245,22517742,23002217,27561249,28683309