SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


general stress protein, binds in the stationary phase to the [SW|ribosome], replaces [protein|035154A4160F084BA1CC124D0951937B203E167D|RpmE] under conditions of zinc limitation
9.39 kDa
protein length
gene length
249 bp Sequence Blast
survival of salt stress
accessory ribosomal protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Ribosomal proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    3,138,978 → 3,139,226

    The protein

    Protein family

  • bacterial [SW|ribosomal protein] bL31 family (with [protein|035154A4160F084BA1CC124D0951937B203E167D|RpmE], according to UniProt)
  • Paralogous protein(s)

  • [protein|035154A4160F084BA1CC124D0951937B203E167D|RpmE]
  • Modification

  • phosphorylated on Arg-70 [Pubmed|22517742]
  • Structure

  • [PDB|5O5J] (30S ribosome subunit of Mycobacterium smegmatis, 43% identity) [pubmed|28683309]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]: repression, in the presence of zinc [PubMed|12904577,15049826], in [regulon|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials


  • MGNA-A292 (ytiA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30700 (Δ[gene|DAE7AB27A4C42BF50556BB76F33BEFA8DF35EA3A|rpmEB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGTATCTCCTTTCAAT, downstream forward: _UP4_TAAGGCAGGCCTGAGGGTTT
  • BKK30700 (Δ[gene|DAE7AB27A4C42BF50556BB76F33BEFA8DF35EA3A|rpmEB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGTATCTCCTTTCAAT, downstream forward: _UP4_TAAGGCAGGCCTGAGGGTTT
  • References

  • 17163968,15049826,16547061,12904577,22383849,15805528,19648245,22517742,23002217,27561249,28683309