SubtiBank SubtiBank
mtbP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mtbP

DNA (cytosine-5-)-methyltransferase
locus
BSU_20250
pI
7.80
mw
50.35 kDa
protein length
443 aa Sequence Blast
gene length
1332 bp Sequence Blast
function
DNA modification
product
DNA (cytosine-5-)-methyltransferase
essential
no
ec
2.1.1.37
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.4|DNA restriction/ modification]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,171,401 → 2,172,732

    The protein

    Catalyzed reaction/ biological activity

  • 2'-deoxycytidine in DNA + S-adenosyl-L-methionine --> 5-methyl-2'-deoxycytidine in DNA + H+ + S-adenosyl-L-homocysteine (according to UniProt)
  • Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • [SW|class I-like SAM-binding methyltransferase superfamily] (according to UniProt)
  • [SW|Domains]

  • SAM-dependent MTase C5-type domain (aa 4-440) (according to UniProt)
  • Structure

  • [PDB|1MHT] (from Haemophilus haemolyticus, 28% identity) [pubmed|8293469]
  • Biological materials

    Mutant

  • BKE20250 (Δ[gene|DAE0C61FD9902AD3092A779105B4A0E656069266|mtbP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACAAACAACCTCCATATA, downstream forward: _UP4_TAAAATTTGTCTTTTAAACA
  • BKK20250 (Δ[gene|DAE0C61FD9902AD3092A779105B4A0E656069266|mtbP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACAAACAACCTCCATATA, downstream forward: _UP4_TAAAATTTGTCTTTTAAACA
  • References

    Research papers

  • 8293469