SubtiBank SubtiBank
albD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

albD

ABC transporter (membrane protein), export of antilisterial bacteriocin (subtilosin)
locus
BSU37400
pI
10.12
mw
49.35 kDa
protein length
436 aa Sequence Blast
gene length
1311 bp Sequence Blast
function
export of antilisterial bacteriocin (subtilosin)
product
ABC transporter (membrane protein)
essential
no
synonyms
ywhP

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.2|Export of antibiotic substances]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,838,552 → 3,839,862

    The protein

    [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|8CBBEC47A5CC3EAE73BE68E68417C5F2A4DA5C23|sboA]-[gene|83AAFAA187B4FCEE24B4EA2DD4935425A3B48DAA|sboX]-[gene|DEDA6F03386F360F6C0B2CC5F09DF3C9D85173F1|albA]-[gene|D399B25AE22ECB6C7ACDCFF4DCE4D9D908184E75|albB]-[gene|19CC58F5ABADAD45BA55D88BBD77B586AA5D85FE|albC]-[gene|DAD8308DF72E648610D1A12BC92063E1550CB1B4|albD]-[gene|A474F01AA4AD859963E39CD528BC42FF43A72433|albE]-[gene|D03FB4EAEFBC25A5B0459CF464BFADF1FC7620B2|albF]-[gene|55A34610EF7AA5E515DE3DCDA333ED3A42B0EF08|albG]
    description
    [Pubmed|10572140]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10572140], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10809710], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|10572140,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [Pubmed|10809710]
  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A528 (ywhP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/528 NBRP B. subtilis, Japan]
  • BKE37400 (Δ[gene|DAD8308DF72E648610D1A12BC92063E1550CB1B4|albD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTATTCATGGCCGATCAC, downstream forward: _UP4_GGCTTGGAAGTTAACCTGCT
  • BKK37400 (Δ[gene|DAD8308DF72E648610D1A12BC92063E1550CB1B4|albD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTATTCATGGCCGATCAC, downstream forward: _UP4_GGCTTGGAAGTTAACCTGCT
  • References

  • 10809709,10092453,10572140,15743949,10809710,10572140,17720793