SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


ABC transporter (membrane protein), export of antilisterial bacteriocin (subtilosin)
49.35 kDa
protein length
436 aa Sequence Blast
gene length
1311 bp Sequence Blast
export of antilisterial bacteriocin (subtilosin)
ABC transporter (membrane protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Exporters] → [category|SW|Export of antibiotic substances]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,838,552 → 3,839,862

    The protein


  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10572140], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10809710], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|10572140,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [Pubmed|10809710]
  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials


  • MGNA-A528 (ywhP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37400 (Δ[gene|DAD8308DF72E648610D1A12BC92063E1550CB1B4|albD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTATTCATGGCCGATCAC, downstream forward: _UP4_GGCTTGGAAGTTAACCTGCT
  • BKK37400 (Δ[gene|DAD8308DF72E648610D1A12BC92063E1550CB1B4|albD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTATTCATGGCCGATCAC, downstream forward: _UP4_GGCTTGGAAGTTAACCTGCT
  • References

  • 10809709,10092453,10572140,15743949,10809710,10572140,17720793