SubtiBank SubtiBank
ackA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ackA

acetate kinase
locus
BSU_29470
pI
5.19
mw
42.98 kDa
protein length
395 aa Sequence Blast
gene length
1188 bp Sequence Blast
function
overflow metabolism
product
acetate kinase
essential
no
ec
2.7.2.1
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.5|ATP synthesis] → [category|SW 2.1.5.2|Substrate-level phosphorylation]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.5|Overflow metabolism]
  • Gene

    Coordinates
    3,015,111 → 3,016,298

    The protein

    Catalyzed reaction/ biological activity

  • acetate + ATP --> acetyl phosphate + ADP (according to UniProt)
  • Protein family

  • acetokinase family (with [protein|8E08A0333E4EC89003DA3C1DD8DCD39CDDC8624C|Buk], according to UniProt)
  • Structure

  • [PDB|2IIR] (from ''Thermotoga maritima'', 54% identity, 73% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|DAA285C86692E8B47D48652E0973AE3FF091CBC3|ackA]
    description
    [Pubmed|8226682]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8226682], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: activation, [Pubmed|16995897], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: activation, [Pubmed|8226682,12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • activated during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|16995897]
  • view in new tab

    Biological materials

    Mutant

  • GP1902 (''ackA''::''aphA3'') (available in [SW|Jörg Stülke]'s lab)
  • BKE29470 (Δ[gene|DAA285C86692E8B47D48652E0973AE3FF091CBC3|ackA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTGACGCTCCTTTAT, downstream forward: _UP4_TAAATCGCATGAAAGCACAT
  • BKK29470 (Δ[gene|DAA285C86692E8B47D48652E0973AE3FF091CBC3|ackA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTGACGCTCCTTTAT, downstream forward: _UP4_TAAATCGCATGAAAGCACAT
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
  • References

    Reviews

  • 16678422,15755952
  • Original publications

  • 8226682,9811655,15378759,11244084,16995897,12850135,8226682,9811655,21106498,26098117