SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


catalase, general stress protein
62.19 kDa
protein length
547 aa Sequence Blast
gene length
1644 bp Sequence Blast
detoxification (degradation) of hydrogen peroxide
catalase (major catalase in spores)

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    3,964,997 → 3,966,640

    The protein

    Catalyzed reaction/ biological activity

  • 2 H2O2 = O2 + 2 H2O (according to Swiss-Prot)
  • Protein family

  • catalase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|B0A1AB6E920E6CBEE45115297599AF9A80972E38|KatA], [protein|03FE63D6AAC77D6CEB052D0BF578ACD048C772FB|KatE]
  • Structure

  • [PDB|4CAB] (from Deinococcus radiodurans, 69% identity) [pubmed|24975828]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10503549,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|10503549,16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|7C0458DB0E3E3AC952FB9DDBC4AD220A3A456359|RsfA]: activation, [Pubmed|10629188], in [regulon|7C0458DB0E3E3AC952FB9DDBC4AD220A3A456359|RsfA regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF], [protein|search|RsfA]) [Pubmed|16497325,15699190,10629188]
  • view in new tab

    Biological materials


  • MGNA-B755 (katX::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38630 (Δ[gene|DA5EB526EE8AF41BE9B837F2C276432BC4183AA1|katX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGGTTGGCCCTCCTTTT, downstream forward: _UP4_TAACAACAGCGAACAGGGCT
  • BKK38630 (Δ[gene|DA5EB526EE8AF41BE9B837F2C276432BC4183AA1|katX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGGTTGGCCCTCCTTTT, downstream forward: _UP4_TAACAACAGCGAACAGGGCT
  • References

  • 9393707,10503549,16497325,9555886,15805528,10629188,24975828