SubtiBank SubtiBank
katX
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

katX

catalase, general stress protein
locus
BSU_38630
pI
5.34
mw
62.19 kDa
protein length
547 aa Sequence Blast
gene length
1644 bp Sequence Blast
function
detoxification (degradation) of hydrogen peroxide
product
catalase (major catalase in spores)
essential
no
synonyms
yxlI

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    3,964,997 → 3,966,640

    The protein

    Catalyzed reaction/ biological activity

  • 2 H2O2 --> 2 H2O + O2 (according to UniProt)
  • Protein family

  • [SW|catalase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B0A1AB6E920E6CBEE45115297599AF9A80972E38|KatA], [protein|03FE63D6AAC77D6CEB052D0BF578ACD048C772FB|KatE]
  • Structure

  • [PDB|4CAB] (from Deinococcus radiodurans, 69% identity) [pubmed|24975828]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|DA5EB526EE8AF41BE9B837F2C276432BC4183AA1|katX]
    description
    [Pubmed|10503549]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10503549,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|10503549,16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|7C0458DB0E3E3AC952FB9DDBC4AD220A3A456359|RsfA]: activation, [Pubmed|10629188], in [regulon|7C0458DB0E3E3AC952FB9DDBC4AD220A3A456359|RsfA regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF], [protein|search|RsfA]) [Pubmed|16497325,15699190,10629188]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B755 (katX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1754 NBRP B. subtilis, Japan]
  • BKE38630 (Δ[gene|DA5EB526EE8AF41BE9B837F2C276432BC4183AA1|katX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGGTTGGCCCTCCTTTT, downstream forward: _UP4_TAACAACAGCGAACAGGGCT
  • BKK38630 (Δ[gene|DA5EB526EE8AF41BE9B837F2C276432BC4183AA1|katX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGGTTGGCCCTCCTTTT, downstream forward: _UP4_TAACAACAGCGAACAGGGCT
  • References

  • 9393707,10503549,16497325,9555886,15805528,10629188,24975828