SubtiBank SubtiBank
csaA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

csaA

molecular chaperone involved in protein secretion
locus
BSU_19040
pI
8.69
mw
11.77 kDa
protein length
110 aa Sequence Blast
gene length
333 bp Sequence Blast
function
protein secretion
product
molecular chaperone
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • Gene

    Coordinates
    2,079,214 → 2,079,546

    Phenotypes of a mutant

  • From unsuccessful trials to knock out the gene it was concluded that ''csaA'' apparently is essential. However, in a conditional mutant (Pspac-''csaA''), depletion of the gene product is not lethal. But secretion of some proteins including [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|SdpC] was reported to be affected unter such conditions.[Pubmed|10816431]
  • The protein

    Catalyzed reaction/ biological activity

  • Secretion associated chaperone. Assumed functional analogue of ''E. coli'' SecB
  • Protein family

  • FIG1 subfamily (according to Swiss-Prot)
  • [SW|Domains]

  • [SW|tRNA-binding domain] (aa 6-110) (accordinig to UniProt)
  • Structure

  • [PDB|2NZO]
  • [SW|Localization]

  • cytoplasm [pubmed|10816431]
  • Additional information

  • The functional entity of CsaA is the homodimer [pubmed|17372352]
  • Expression and Regulation

    Operons

    genes
    [gene|EDD0C5732E487A7F94684289F59B9130773316C1|yobT]-[gene|BB122C73972ACEA08DE97F95FC9AC249671C86A3|yobS]-[gene|6D9AAA63C4E43D2F80C7A2104BDF4D98A21C3B78|yobR]-[gene|6C67AD722D59671ED7589949690773732A8B845F|yobQ]-[gene|DA4A64BDF322EDE9EECE83AC9D4AAA01D3F16720|csaA]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|6D9AAA63C4E43D2F80C7A2104BDF4D98A21C3B78|yobR]-[gene|6C67AD722D59671ED7589949690773732A8B845F|yobQ]-[gene|DA4A64BDF322EDE9EECE83AC9D4AAA01D3F16720|csaA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • Pspac-csaA [Pubmed|10816431]
  • BKE19040 (Δ[gene|DA4A64BDF322EDE9EECE83AC9D4AAA01D3F16720|csaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAATAACTCCTTTTT, downstream forward: _UP4_TAACGCAAAAAAAGACGTTT
  • BKK19040 (Δ[gene|DA4A64BDF322EDE9EECE83AC9D4AAA01D3F16720|csaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAATAACTCCTTTTT, downstream forward: _UP4_TAACGCAAAAAAAGACGTTT
  • References

    Reviews

  • 25212246,28724440
  • Original publications

  • 10816431,13129613,17372352,10658654