SubtiBank SubtiBank
ygaJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ygaJ

similar to peptidase
locus
BSU_08780
pI
6.05
mw
28.14 kDa
protein length
230 aa Sequence Blast
gene length
693 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    954,893 → 955,585

    The protein

    Protein family

  • Peptidase S51 family (single member, according to UniProt)
  • Biological materials

    Mutant

  • MGNA-A245 (ygaJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/245 NBRP B. subtilis, Japan]
  • BKE08780 (Δ[gene|DA2021808575E4CE9D04BECD17B7A929B50ADC1A|ygaJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCACACCCCCCAACA, downstream forward: _UP4_TGAAATTGGCTGAATATTAT
  • BKK08780 (Δ[gene|DA2021808575E4CE9D04BECD17B7A929B50ADC1A|ygaJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCACACCCCCCAACA, downstream forward: _UP4_TGAAATTGGCTGAATATTAT
  • References

    Research papers

  • 30968972