SubtiBank SubtiBank
ylbA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ylbA

unknown
locus
BSU_14940
pI
4.98
mw
13.35 kDa
protein length
120 aa Sequence Blast
gene length
363 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,565,347 → 1,565,709

    The protein

    Structure

  • [PDB|2R5X] (from Geobacillus kaustophilus, 53% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|DA07722C01A96CCB5A2A6DC6899D0D86C791A3E7|ylbA]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B358 (ylbA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1357 NBRP B. subtilis, Japan]
  • BKE14940 (Δ[gene|DA07722C01A96CCB5A2A6DC6899D0D86C791A3E7|ylbA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGACCCCTCCTTATAAA, downstream forward: _UP4_TAACGAAAAGGTACAGCATA
  • BKK14940 (Δ[gene|DA07722C01A96CCB5A2A6DC6899D0D86C791A3E7|ylbA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGACCCCTCCTTATAAA, downstream forward: _UP4_TAACGAAAAGGTACAGCATA
  • References

  • 20817675