SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


13.35 kDa
protein length
120 aa Sequence Blast
gene length
363 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,565,347 → 1,565,709

    The protein


  • [PDB|2R5X] (from Geobacillus kaustophilus, 53% identity)
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • MGNA-B358 (ylbA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE14940 (Δ[gene|DA07722C01A96CCB5A2A6DC6899D0D86C791A3E7|ylbA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGACCCCTCCTTATAAA, downstream forward: _UP4_TAACGAAAAGGTACAGCATA
  • BKK14940 (Δ[gene|DA07722C01A96CCB5A2A6DC6899D0D86C791A3E7|ylbA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGACCCCTCCTTATAAA, downstream forward: _UP4_TAACGAAAAGGTACAGCATA
  • References

  • 20817675