SubtiBank SubtiBank
yqiB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqiB

similar to exodeoxyribonuclease VII (large subunit)
locus
BSU_24300
pI
9.55
mw
50.85 kDa
protein length
448 aa Sequence Blast
gene length
1347 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.8|Genetics/ other/ based on similarity]
  • Gene

    Coordinates
    2,526,920 → 2,528,266

    The protein

    Catalyzed reaction/ biological activity

  • Exonucleolytic cleavage in either 5'- to 3'- or 3'- to 5'-direction to yield nucleoside 5'-phosphates (according to UniProt)
  • Protein family

  • xseA family (single member, according to UniProt)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot), Cytoplasm (Homogeneous) [Pubmed|16479537]
  • Biological materials

    Mutant

  • BKE24300 (Δ[gene|D9DCD38A0BCDEE2EF6A19A2CC13A3A0ACB216C37|yqiB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTAAAAACTCCTCTC, downstream forward: _UP4_TTAGAAAAGAGAGGGGAAGA
  • BKK24300 (Δ[gene|D9DCD38A0BCDEE2EF6A19A2CC13A3A0ACB216C37|yqiB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTAAAAACTCCTCTC, downstream forward: _UP4_TTAGAAAAGAGAGGGGAAGA
  • References

  • 16479537,21170359,27120414