SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


32.74 kDa
protein length
305 aa Sequence Blast
gene length
918 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    4,190,209 → 4,191,126

    The protein

    Protein family

  • [SW|EamA transporter family] (according to UniProt)
  • [SW|Domains]

  • 2 [SW|EamA domain]s (aa 15-140, aa 164-290) (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B861 (yyaM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE40810 (Δ[gene|D9D907A6004AFE7A4D7BB92A8955593F00DC7A2C|yyaM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGTATATATTTAAAT, downstream forward: _UP4_TAAAGAAATAGGGAGTATTT
  • BKK40810 (Δ[gene|D9D907A6004AFE7A4D7BB92A8955593F00DC7A2C|yyaM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGTATATATTTAAAT, downstream forward: _UP4_TAAAGAAATAGGGAGTATTT