SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


16.85 kDa
protein length
142 aa Sequence Blast
gene length
429 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,924,993 → 1,925,421

    The protein


  • membrane, forms foci at the site of septation [Pubmed|23060960]
  • Expression and Regulation



    additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yneK]' and '[protein|search|cotM]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • MGNA-B391 (yneK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE17960 (Δ[gene|D9D672A76DB6B179AFEB1B3661A5C2FDA9311188|yneK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATCATTCCCCCTTAT, downstream forward: _UP4_TAAAAAACCTTTCCTGACAA
  • BKK17960 (Δ[gene|D9D672A76DB6B179AFEB1B3661A5C2FDA9311188|yneK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATCATTCCCCCTTAT, downstream forward: _UP4_TAAAAAACCTTTCCTGACAA
  • References

  • 9068642,20525796,23060960