SubtiBank SubtiBank
yneK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yneK

unknown
locus
BSU_17960
pI
9.66
mw
16.85 kDa
protein length
142 aa Sequence Blast
gene length
429 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yoxJ

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,924,993 → 1,925,421

    The protein

    [SW|Localization]

  • membrane, forms foci at the site of septation [Pubmed|23060960]
  • Expression and Regulation

    Operons

    genes
    [gene|D9D672A76DB6B179AFEB1B3661A5C2FDA9311188|yneK]
    description
    [Pubmed|9068642]

    additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yneK]' and '[protein|search|cotM]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B391 (yneK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1390 NBRP B. subtilis, Japan]
  • BKE17960 (Δ[gene|D9D672A76DB6B179AFEB1B3661A5C2FDA9311188|yneK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATCATTCCCCCTTAT, downstream forward: _UP4_TAAAAAACCTTTCCTGACAA
  • BKK17960 (Δ[gene|D9D672A76DB6B179AFEB1B3661A5C2FDA9311188|yneK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATCATTCCCCCTTAT, downstream forward: _UP4_TAAAAAACCTTTCCTGACAA
  • References

  • 9068642,20525796,23060960