SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


12.32 kDa
protein length
105 aa Sequence Blast
gene length
318 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,268,275 → 1,268,592

    The protein


  • [SW|ABM domain] (aa 14-104) (according to UniProt)
  • Structure

  • [PDB|1Q8B]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B302 (yjcS::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE11970 (Δ[gene|D9C06D872E2531B6A72C0AA18B42CEAE09698041|yjcS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATAACATTTTCTTGAA, downstream forward: _UP4_TGAAAGGCTCTTTAAAAAGA
  • BKK11970 (Δ[gene|D9C06D872E2531B6A72C0AA18B42CEAE09698041|yjcS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATAACATTTTCTTGAA, downstream forward: _UP4_TGAAAGGCTCTTTAAAAAGA