SubtiBank SubtiBank
bioD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bioD

dethiobiotin synthase
locus
BSU30210
pI
6.21
mw
25.01 kDa
protein length
231 aa Sequence Blast
gene length
696 bp Sequence Blast
function
biosynthesis of biotin
product
dethiobiotin synthase
essential
no
ec
6.3.3.3
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.1|Biosynthesis/ acquisition of biotin]
  • Gene

    Coordinates
    3,091,492 → 3,092,187

    The protein

    Catalyzed reaction/ biological activity

  • ATP + 7,8-diaminononanoate + CO2 = ADP + phosphate + dethiobiotin (according to Swiss-Prot)
  • Protein family

  • dethiobiotin synthetase family (according to Swiss-Prot)
  • Structure

  • [PDB|1DTS] (from E. coli, 32% identity) [pubmed|8081756]
  • Expression and Regulation

    Operons

    genes
    [gene|C40116089BAD3F9831F8C837DC4F2E045753ABDE|bioW]-[gene|68C86FED3575B864C576DFB73FE7B5BF83994D1F|bioA]-[gene|8B6A3E86A88928526D94FDA94B9C81ABF6E9ACFB|bioF]-[gene|D9A71DAF949FB6C9C22C8361D83C5A0741184977|bioD]-[gene|5880617EB95FC0D19219A868D6D0A3D1D0D9C532|bioB]-[gene|8FBC9A1AC108DC99E275D7A27C18C797D3CDB936|bioI]-[gene|089A32D08B5A7E552CBD9CB9745BD542863B4558|ytbQ]
    description
    [Pubmed|8763940,8892842]

    regulatory mechanism

  • [protein|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA]: repression, [Pubmed|8763940,8892842], in [regulon|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA regulon]
  • regulation

  • repressed in the presence of biotin ([protein|search|BirA]) [Pubmed|8763940,8892842]
  • view in new tab

    Biological materials

    Mutant

  • BKE30210 (Δ[gene|D9A71DAF949FB6C9C22C8361D83C5A0741184977|bioD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTTCCCGTCACAAAAAAAC, downstream forward: _UP4_ATGAATCAAGTGGGGGTATG
  • BKK30210 (Δ[gene|D9A71DAF949FB6C9C22C8361D83C5A0741184977|bioD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTTCCCGTCACAAAAAAAC, downstream forward: _UP4_ATGAATCAAGTGGGGGTATG
  • References

    Reviews

  • 21437340
  • Original publications

  • 8763940,8892842,8081756