SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


dethiobiotin synthase
25.01 kDa
protein length
231 aa Sequence Blast
gene length
696 bp Sequence Blast
biosynthesis of biotin
dethiobiotin synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis/ acquisition of biotin]
  • Gene

    3,091,492 → 3,092,187

    The protein

    Catalyzed reaction/ biological activity

  • 7,8-diaminononanoate + ATP + CO2 = ADP + dethiobiotin + 3 H+ + phosphate (according to UniProt)
  • Protein family

  • dethiobiotin synthetase family (single member, according to UniProt)
  • Structure

  • [PDB|1DTS] (from E. coli, 32% identity) [pubmed|8081756]
  • Expression and Regulation



    regulatory mechanism

  • [protein|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA]: repression, [Pubmed|8763940,8892842], in [regulon|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA regulon]
  • regulation

  • repressed in the presence of biotin ([protein|search|BirA]) [Pubmed|8763940,8892842]
  • view in new tab

    Biological materials


  • BKE30210 (Δ[gene|D9A71DAF949FB6C9C22C8361D83C5A0741184977|bioD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTTCCCGTCACAAAAAAAC, downstream forward: _UP4_ATGAATCAAGTGGGGGTATG
  • BKK30210 (Δ[gene|D9A71DAF949FB6C9C22C8361D83C5A0741184977|bioD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTTCCCGTCACAAAAAAAC, downstream forward: _UP4_ATGAATCAAGTGGGGGTATG
  • References


  • 21437340
  • Original publications

  • 8763940,8892842,8081756