SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


[SW|MarR family|MarR/DUF24 family] transcription activator of the [gene|BF480721B89661BFFE6632BB10C5F4DC29951784|hxlA]-[gene|FB0CEA291CA4EC5FB8410050E61B89EDBA1771F9|hxlB] operon
14.01 kDa
protein length
120 aa Sequence Blast
gene length
363 bp Sequence Blast
regulation of the ribulose monophosphate pathway
[SW|MarR family|MarR/DUF24 family] transcription activator

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    376,032 → 376,394

    The protein

    Catalyzed reaction/ biological activity

  • transcription activation of the ribulose monophosphate pathway for formaldehyde fixation and detoxification
  • Protein family

  • [SW|MarR family|MarR/DUF24 family]
  • Paralogous protein(s)

  • [protein|E757C4B329A99E3D0C70C77437DF4DDA300CA5E7|YdzF], [protein|91085DA5E71B88E533D2E1D1BFB53E908116C6AA|HypR], [protein|51B1913B59C1876CCED4A88414797B3A22BE4E3C|YdeP], [protein|1E74F0557FF9ECB404B6544831F4E0A162473423|YtcD], [protein|C57DDC9710CB557179B062F9C5D786DB02A3B5FC|YkvN], [protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB]
  • Effectors of protein activity

  • formaldehyde stimulates transcription activation by HxlR
  • Structure

  • [PDB|4A5M] ([protein|91085DA5E71B88E533D2E1D1BFB53E908116C6AA|HypR], 54% identity) [pubmed|22238377]
  • Expression and Regulation



    additional information

  • A [SW|search|ncRNA] is predicted between [gene|D9A187961CFB9496A6712E9E48AAD384357A3E1C|hxlR] and [gene|81845F44CE2C601555066E31E87384FF5D7B4139|srfAA] [PubMed|20525796]
  • view in new tab

    Biological materials


  • BKE03470 (Δ[gene|D9A187961CFB9496A6712E9E48AAD384357A3E1C|hxlR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAGAATCCCCCCCCTTA, downstream forward: _UP4_TAAGACGCTCTTCGCAAGGG
  • BKK03470 (Δ[gene|D9A187961CFB9496A6712E9E48AAD384357A3E1C|hxlR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAGAATCCCCCCCCTTA, downstream forward: _UP4_TAAGACGCTCTTCGCAAGGG
  • References

  • 10572115,20525796,16428816,19170879,22238377