SubtiBank SubtiBank
tdk
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

tdk

thymidine kinase
locus
BSU_37060
pI
5.69
mw
21.30 kDa
protein length
195 aa Sequence Blast
gene length
588 bp Sequence Blast
function
biosynthesis of thymidine nucleotides
product
thymidine kinase (ATP:thymidine)
essential
no
ec
2.7.1.21
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.4|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • Gene

    Coordinates
    3,802,405 → 3,802,992

    The protein

    Catalyzed reaction/ biological activity

  • ATP + thymidine --> ADP + dTMP + H+ (according to UniProt)
  • Protein family

  • thymidine kinase family (single member, according to UniProt)
  • Structure

  • [PDB|2JA1] (from B. cereus, 69% identity) [pubmed|17288553]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Biological materials

    Mutant

  • BKE37060 (Δ[gene|D97D4CFDF7A9A48A8764738ECFD42F1D3A900BE7|tdk]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGCTTCGCTCCCCTCT, downstream forward: _UP4_TAGTCCAAAACATGGGTATA
  • BKK37060 (Δ[gene|D97D4CFDF7A9A48A8764738ECFD42F1D3A900BE7|tdk]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGCTTCGCTCCCCTCT, downstream forward: _UP4_TAGTCCAAAACATGGGTATA
  • References

    Research papers

  • 17288553