SubtiBank SubtiBank
tdk
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tdk

thymidine kinase
locus
BSU37060
pI
5.69
mw
21.30 kDa
protein length
195 aa Sequence Blast
gene length
588 bp Sequence Blast
function
biosynthesis of thymidine nucleotides
product
thymidine kinase (ATP:thymidine)
essential
no
ec
2.7.1.21
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.4|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • Gene

    Coordinates
    3,802,405 → 3,802,992

    The protein

    Catalyzed reaction/ biological activity

  • ATP + thymidine = ADP + thymidine 5'-phosphate (according to Swiss-Prot)
  • Protein family

  • thymidine kinase family (according to Swiss-Prot)
  • Structure

  • [PDB|2JA1] (from B. cereus, 69% identity) [pubmed|17288553]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Biological materials

    Mutant

  • BKE37060 (Δ[gene|D97D4CFDF7A9A48A8764738ECFD42F1D3A900BE7|tdk]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGCTTCGCTCCCCTCT, downstream forward: _UP4_TAGTCCAAAACATGGGTATA
  • BKK37060 (Δ[gene|D97D4CFDF7A9A48A8764738ECFD42F1D3A900BE7|tdk]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGCTTCGCTCCCCTCT, downstream forward: _UP4_TAGTCCAAAACATGGGTATA
  • References

    Research papers

  • 17288553