SubtiBank SubtiBank
yxzG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxzG

unknown
locus
BSU_39170
pI
3.85
mw
16.64 kDa
protein length
150 aa Sequence Blast
gene length
453 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,020,455 → 4,020,907

    Biological materials

    Mutant

  • BKE39170 (Δ[gene|D97AFB2DB78403A26A3D0158DE4DFF9502549715|yxzG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACTATGGCCGTTGGGAT, downstream forward: _UP4_CAATAAGGTGTAGGGATGAG
  • BKK39170 (Δ[gene|D97AFB2DB78403A26A3D0158DE4DFF9502549715|yxzG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACTATGGCCGTTGGGAT, downstream forward: _UP4_CAATAAGGTGTAGGGATGAG