SubtiBank SubtiBank
yxeM
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yxeM

putative S-(2-succino)cysteine [SW|ABC transporter] (binding protein)
locus
BSU_39500
pI
9.09
mw
29.16 kDa
protein length
264 aa Sequence Blast
gene length
795 bp Sequence Blast
function
uptake and utilization of S-(2-succino)cysteine
product
putative S-(2-succino)cysteine [SW|ABC transporter] (binding protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.2|Uptake of amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.9|Biosynthesis/ acquisition of cysteine]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.3|Conversion of S-(2-succino)cysteine to cysteine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,059,488 → 4,060,282

    The protein

    Protein family

  • [SW|bacterial solute-binding protein 3 family] (according to UniProt)
  • Structure

  • [PDB|4ZV1] (synthetic, 38% identity) [pubmed|26853627]
  • [SW|Localization]

  • associated to the membrane (via [protein|FFD5F07480A0E5A74852C69C436EE289BA72FC7F|YxeN]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|19E6EF9CCA31440EAC046F8D6CA98B6A08589D58|yxeK]-[gene|EBC2B9107AD50DD8F8174FC0BE4AD90DEE6A7CCA|snaB]-[gene|D96EEDABB73AC66E6AB772431819E7C767DC8B9A|yxeM]-[gene|FFD5F07480A0E5A74852C69C436EE289BA72FC7F|yxeN]-[gene|F8C800CF71D21A1F3265977C4F0EE191D0FFE36A|yxeO]-[gene|C99AA3FDBB561BCED60915078DC746690C071753|sndB]-[gene|7DDB283173267AA106DC277787AAAB4F4F9975F4|yxeQ]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16513748], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • regulation

  • repressed in the presence of cysteine ([protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]) [Pubmed|16513748]
  • additional information

  • the amount of the mRNA is substantially decreased upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B782 (yxeM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1781 NBRP B. subtilis, Japan]
  • 1A950 ( ''yxeM''::''cat''), [Pubmed|15262924], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A950&Search=1A950 BGSC]
  • BKE39500 (Δ[gene|D96EEDABB73AC66E6AB772431819E7C767DC8B9A|yxeM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATTTTCCCGCCTTT, downstream forward: _UP4_TAAGAAACGGCGGTGACTCA
  • BKK39500 (Δ[gene|D96EEDABB73AC66E6AB772431819E7C767DC8B9A|yxeM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATTTTCCCGCCTTT, downstream forward: _UP4_TAAGAAACGGCGGTGACTCA
  • References

  • 10092453,12193636,16513748,10746760,21815947,29626092,26853627