SubtiBank SubtiBank
gerAC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gerAC

lipoprotein, nutrient receptor, [SW|germination] response to L-alanine, triggers premature [SW|germination] in response to morphological defects during [SW|sporulation]
locus
BSU33070
pI
7.30
mw
42.23 kDa
protein length
373 aa Sequence Blast
gene length
1122 bp Sequence Blast
function
germination response to L-alanine
product
nutrient receptor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.1|Germinant receptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,393,293 → 3,394,414

    Phenotypes of a mutant

  • suppresses the defects of [gene|40BCEB3648585961D22B71BBB4FB62EE4B3E360D|spoVV] mutant spores [pubmed|28605069]
  • The protein

    Catalyzed reaction/ biological activity

  • triggers premature [SW|germination] in response to morphological defects during [SW|sporulation] [pubmed|28605069]
  • Protein family

  • [SW|GerABKC lipoprotein family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|93D4D6864686E6E559E6CEFA69BAC77EEFAA1BE3|GerBC]
  • [SW|Domains]

  • has an N-terminal signal sequence, lipidated on a Cys residue adjacent to the signal peptide [Pubmed|23335419]
  • Structure

  • [PDB|3N54] ([protein|93D4D6864686E6E559E6CEFA69BAC77EEFAA1BE3|GerBC], 34% identity) [pubmed|20654628]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • outer surface of the inner spore membrane [Pubmed|23335419,21378181]
  • Additional information

  • 1,100 molecules are present per spore [Pubmed|23749970]
  • Expression and Regulation

    Operons

    genes
    [gene|EEDE6A22E91992ABCA677CAB7917B7168C5CB868|gerAA]-[gene|5FF739B8C087207039BB6DC293EE77F59337ED0B|gerAB]-[gene|D937E26DF69D49B1341B37596AC6A8FBEEF8BA2E|gerAC]
    description
    [Pubmed|3110007]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, [Pubmed|8755877], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigF], [protein|search|SigG], [SW|SpoVT]) [Pubmed|16497325,15699190,8755877]
  • additional information

  • 1,100 molecules are present per spore [PubMed|23749970]
  • view in new tab

    Biological materials

    Mutant

  • BKE33070 (Δ[gene|D937E26DF69D49B1341B37596AC6A8FBEEF8BA2E|gerAC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAACATACATAAAATCCGGA, downstream forward: _UP4_AAAGGCGCAAACAAATAGCA
  • BKK33070 (Δ[gene|D937E26DF69D49B1341B37596AC6A8FBEEF8BA2E|gerAC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAACATACATAAAATCCGGA, downstream forward: _UP4_AAAGGCGCAAACAAATAGCA
  • References

    Reviews

  • 27337279
  • Original publications

  • 3110007,17573930,12670969,2110996,15774895,16497325,16352818,8755877,21378181,21378197,21696470,15126458,22327596,22493018,23335419,23396907,22343299,16740944,23749970,24752279,24916603,11418573,28605069,20654628