SubtiBank SubtiBank
yjiB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjiB

cytochrome P450, monooxygenase CYP109B1
locus
BSU_12210
pI
5.38
mw
44.83 kDa
protein length
396 aa Sequence Blast
gene length
1191 bp Sequence Blast
function
oxidation of fatty acids
product
monooxygenase CYP109B1
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.3|Lipid metabolism/ other]
  • Gene

    Coordinates
    1,291,344 → 1,292,534

    The protein

    Catalyzed reaction/ biological activity

  • oxidation of saturated fatty acids (conversion up to 99%) and their methyl and ethyl esters (conversion up to 80%) at subterminal positions with a preference for the carbon atoms C11 and C12 counted from the carboxyl group [Pubmed|20186410]
  • Protein family

  • [SW|cytochrome P450] family (according to UniProt)
  • Paralogous protein(s)

  • [protein|EF0F13BB682791E167EFC350BF029B08E8A1F410|PksS], [protein|A95C28DEE73AD25E28C45B88A7C03C92835F9705|CypA], [protein|8FBC9A1AC108DC99E275D7A27C18C797D3CDB936|BioI]
  • Structure

  • [PDB|4RM4] [Pubmed|25587700]
  • Expression and Regulation

    Operons

    genes
    [gene|D8E72C2523D5E6214C9CBAC2C1B27EA45378E162|yjiB]-[gene|02927D2CC9F44B99DB307DDFED2DD52DE2196120|yjiC]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [pubmed|26577401]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A349 (yjiB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/349 NBRP B. subtilis, Japan]
  • BKE12210 (Δ[gene|D8E72C2523D5E6214C9CBAC2C1B27EA45378E162|yjiB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACGGTCACTCCCCTT, downstream forward: _UP4_TAATAGATAAGGAGACTGGA
  • BKK12210 (Δ[gene|D8E72C2523D5E6214C9CBAC2C1B27EA45378E162|yjiB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACGGTCACTCCCCTT, downstream forward: _UP4_TAATAGATAAGGAGACTGGA
  • References

  • 19591681,20186410,25587700,22383849