SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


cytochrome P450, monooxygenase CYP109B1
44.83 kDa
protein length
396 aa Sequence Blast
gene length
1191 bp Sequence Blast
oxidation of fatty acids
monooxygenase CYP109B1

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.3|Lipid metabolism/ other]
  • Gene

    1,291,344 → 1,292,534

    The protein

    Catalyzed reaction/ biological activity

  • oxidation of saturated fatty acids (conversion up to 99%) and their methyl and ethyl esters (conversion up to 80%) at subterminal positions with a preference for the carbon atoms C11 and C12 counted from the carboxyl group [Pubmed|20186410]
  • Protein family

  • [SW|cytochrome P450] family (according to UniProt)
  • Paralogous protein(s)

  • [protein|EF0F13BB682791E167EFC350BF029B08E8A1F410|PksS], [protein|A95C28DEE73AD25E28C45B88A7C03C92835F9705|CypA], [protein|8FBC9A1AC108DC99E275D7A27C18C797D3CDB936|BioI]
  • Structure

  • [PDB|4RM4] [Pubmed|25587700]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [pubmed|26577401]
  • view in new tab

    Biological materials


  • MGNA-A349 (yjiB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE12210 (Δ[gene|D8E72C2523D5E6214C9CBAC2C1B27EA45378E162|yjiB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACGGTCACTCCCCTT, downstream forward: _UP4_TAATAGATAAGGAGACTGGA
  • BKK12210 (Δ[gene|D8E72C2523D5E6214C9CBAC2C1B27EA45378E162|yjiB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACGGTCACTCCCCTT, downstream forward: _UP4_TAATAGATAAGGAGACTGGA
  • References

  • 19591681,20186410,25587700,22383849