SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


cytochrome P450, monooxygenase CYP109B1
44.83 kDa
protein length
396 aa Sequence Blast
gene length
1191 bp Sequence Blast
oxidation of fatty acids
monooxygenase CYP109B1

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.3|Lipid metabolism/ other]
  • Gene

    1,291,344 → 1,292,534

    The protein

    Catalyzed reaction/ biological activity

  • oxidation of saturated fatty acids (conversion up to 99%) and their methyl and ethyl esters (conversion up to 80%) at subterminal positions with a preference for the carbon atoms C11 and C12 counted from the carboxyl group [Pubmed|20186410]
  • Protein family

  • [SW|cytochrome P450] family (according to UniProt)
  • Paralogous protein(s)

  • [protein|EF0F13BB682791E167EFC350BF029B08E8A1F410|PksS], [protein|A95C28DEE73AD25E28C45B88A7C03C92835F9705|CypA], [protein|8FBC9A1AC108DC99E275D7A27C18C797D3CDB936|BioI]
  • Structure

  • [PDB|4RM4] [Pubmed|25587700]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [pubmed|26577401]
  • view in new tab

    Biological materials


  • MGNA-A349 (yjiB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE12210 (Δ[gene|D8E72C2523D5E6214C9CBAC2C1B27EA45378E162|yjiB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACGGTCACTCCCCTT, downstream forward: _UP4_TAATAGATAAGGAGACTGGA
  • BKK12210 (Δ[gene|D8E72C2523D5E6214C9CBAC2C1B27EA45378E162|yjiB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACGGTCACTCCCCTT, downstream forward: _UP4_TAATAGATAAGGAGACTGGA
  • References

  • 19591681,20186410,25587700,22383849