SubtiBank SubtiBank
rocB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rocB

involved in arginine and ornithine utilization
locus
BSU_37770
pI
5.35
mw
64.74 kDa
protein length
566 aa Sequence Blast
gene length
1701 bp Sequence Blast
function
arginine, ornithine and citrulline utilization
product
unknown
essential
no
synonyms
ipa-77d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.4|Utilization of arginine/ ornithine]
  • Gene

    Coordinates
    3,877,192 → 3,878,892

    The protein

    Paralogous protein(s)

  • [protein|D8607250EEE380DA8E1CC291B21D5626FA33313E|YqjN]
  • Expression and Regulation

    Operons

    genes
    [gene|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA]-[gene|D8D79BC7E98754963CA9DC577B90929A5A9CE051|rocB]-[gene|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|rocC]
    description
    [Pubmed|8113162]

    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|8113162], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR]: activation, [Pubmed|8113162], in [regulon|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR regulon]
  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: activation, [Pubmed|7565595], in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • additional information

  • expression of the ''[protein|search|rocA]-[protein|search|rocB]-[protein|search|rocC]'' operon is increased upon depletion of ''[SW|nusA]'' (resulting from increased ''[SW|ahrC]'' expression) [http://www.nature.com/articles/nmicrobiol20157 Reference]
  • view in new tab

    Biological materials

    Mutant

  • BKE37770 (Δ[gene|D8D79BC7E98754963CA9DC577B90929A5A9CE051|rocB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAATTGTCCTCCTGATC, downstream forward: _UP4_AAAGAACCAAAGGGGGAAGG
  • BKK37770 (Δ[gene|D8D79BC7E98754963CA9DC577B90929A5A9CE051|rocB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAATTGTCCTCCTGATC, downstream forward: _UP4_AAAGAACCAAAGGGGGAAGG
  • References

  • 7565595,12618455,8113162,27766092