SubtiBank SubtiBank
rocB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rocB

involved in arginine and ornithine utilization
locus
BSU37770
pI
5.35
mw
64.74 kDa
protein length
566 aa Sequence Blast
gene length
1701 bp Sequence Blast
function
arginine, ornithine and citrulline utilization
product
unknown
essential
no
synonyms
ipa-77d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.4|Utilization of arginine/ ornithine]
  • Gene

    Coordinates
    3,877,192 → 3,878,892

    The protein

    Paralogous protein(s)

  • [protein|D8607250EEE380DA8E1CC291B21D5626FA33313E|YqjN]
  • Expression and Regulation

    Operons

    genes
    [gene|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA]-[gene|D8D79BC7E98754963CA9DC577B90929A5A9CE051|rocB]-[gene|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|rocC]
    description
    [Pubmed|8113162]

    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|8113162], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR]: activation, [Pubmed|8113162], in [regulon|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR regulon]
  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: activation, [Pubmed|7565595], in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • additional information

  • expression of the ''[protein|search|rocA]-[protein|search|rocB]-[protein|search|rocC]'' operon is increased upon depletion of ''[SW|nusA]'' (resulting from increased ''[SW|ahrC]'' expression) [http://www.nature.com/articles/nmicrobiol20157 Reference]
  • view in new tab

    Biological materials

    Mutant

  • BKE37770 (Δ[gene|D8D79BC7E98754963CA9DC577B90929A5A9CE051|rocB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAATTGTCCTCCTGATC, downstream forward: _UP4_AAAGAACCAAAGGGGGAAGG
  • BKK37770 (Δ[gene|D8D79BC7E98754963CA9DC577B90929A5A9CE051|rocB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAATTGTCCTCCTGATC, downstream forward: _UP4_AAAGAACCAAAGGGGGAAGG
  • References

  • 7565595,12618455,8113162,27766092