SubtiBank SubtiBank
gmuD [2018-06-22 18:30:07]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

gmuD [2018-06-22 18:30:07]

54.17 kDa
protein length
465 aa Sequence Blast
gene length
1395 bp Sequence Blast
glucomannan utilization

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of glucomannan]
  • Gene

    628,630 → 630,027

    The protein


  • [PDB|4B3K] (from Streptococcus pyogenes, 50% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|18177310], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]: repression, [Pubmed|18177310], in [regulon|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|18177310], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by cellobiose ([protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]) [Pubmed|18177310]
  • view in new tab

    Biological materials


  • MGNA-C191 (ydhP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05840 (Δ[gene|D8C81A8768E9C6B47B5E196B54DC2A3A8256E7E6|gmuD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCCAAGTCTCTCTCCCCTT, downstream forward: _UP4_TAGATTTTCCTAAAGGTCAA
  • BKK05840 (Δ[gene|D8C81A8768E9C6B47B5E196B54DC2A3A8256E7E6|gmuD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCCAAGTCTCTCTCCCCTT, downstream forward: _UP4_TAGATTTTCCTAAAGGTCAA
  • References

  • 14652714,18177310,15139916,10627040,20817675