SubtiBank SubtiBank
ykoA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ykoA

unknown
locus
BSU_14420
pI
9.73
mw
9.92 kDa
protein length
gene length
270 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,511,923 → 1,512,192

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|D8B01145303B24BF5647DCFD67E7793102775DFD|ykoA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE14420 (Δ[gene|D8B01145303B24BF5647DCFD67E7793102775DFD|ykoA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTGTTCCTCCATGAGA, downstream forward: _UP4_TAAAAACGCCTGCTGTCCTA
  • BKK14420 (Δ[gene|D8B01145303B24BF5647DCFD67E7793102775DFD|ykoA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTGTTCCTCCATGAGA, downstream forward: _UP4_TAAAAACGCCTGCTGTCCTA