SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


K+/H+ antiporter for K+ efflux
18.59 kDa
protein length
165 aa Sequence Blast
gene length
498 bp Sequence Blast
potassium ion efflux
K+/H+ antiporter for K+ efflux

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW|Potassium uptake/ export]
  • [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.1|Targets of c-di-AMP]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,060,427 → 1,060,924

    The protein


  • contains a [SW|RCK_C domain] at the C-terminus (according to UniProt, [ x])
  • Effectors of protein activity

  • binds c-di-AMP, which likely activates export activity [pubmed|31061098]
  • [SW|Localization]

  • cell membrane (peripheral) (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A675 (yhaT::erm), available at the [ NBRP B. subtilis, Japan]
  • GP2078 (Δ[gene|A54E8E38AEF596D09B4BEB64D9F539A8AD34E73D|khtS]-[gene|D8A8FBC05B9665F72A88685D2B33822C2BB84C62|khtT]-[gene|9A54C82323BA9220CAA6041E3745FAB9E222FE78|khtU]::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • BKE09860 (Δ[gene|D8A8FBC05B9665F72A88685D2B33822C2BB84C62|khtT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGAAAATCCCTCCGAAT, downstream forward: _UP4_TCTGGAGAGGGCGTGTGAGC
  • BKK09860 (Δ[gene|D8A8FBC05B9665F72A88685D2B33822C2BB84C62|khtT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGAAAATCCCTCCGAAT, downstream forward: _UP4_TCTGGAGAGGGCGTGTGAGC
  • Expression vectors

  • pGP2906 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References


  • 27935846,31361596
  • Original publications

  • 14987767,17679694,24330391,31061098