SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


preprotein translocase subunit
7.86 kDa
protein length
gene length
231 bp Sequence Blast
protein secretion
preprotein translocase subunit

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,455,093 → 3,455,323

    The protein

    Protein family

  • secG family (single member, according to UniProt)
  • Structure

  • [PDB|3DL8] (structure of the ([protein|5350DC618130E013757EE667B9AFC5F2EC68EC08|SecY]-[protein|1007EA15FB7AF81A44400287DB68BCC497158ACF|SecE]-[protein|D8851F453E5EF18D36F25834A8CB9C61EAF15E44|SecG])-[protein|AD7CD451B4AE638A719C91780339784A7FF0F248|SecA] complex) [Pubmed|18923516]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • ''[protein|search|yvaK]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials


  • BKE33630 (Δ[gene|D8851F453E5EF18D36F25834A8CB9C61EAF15E44|secG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCATACACCTCCAGAC, downstream forward: _UP4_TAGGGCAATGTTTGTATAAG
  • BKK33630 (Δ[gene|D8851F453E5EF18D36F25834A8CB9C61EAF15E44|secG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCATACACCTCCAGAC, downstream forward: _UP4_TAGGGCAATGTTTGTATAAG
  • References


  • 25212246,27890920
  • Original publications

  • 10074070,18923516,17369301,26747607