SubtiBank SubtiBank
secG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

secG

preprotein translocase subunit
locus
BSU_33630
pI
10.41
mw
7.86 kDa
protein length
gene length
231 bp Sequence Blast
function
protein secretion
product
preprotein translocase subunit
essential
no
synonyms
yvaL

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,455,093 → 3,455,323

    The protein

    Protein family

  • secG family (single member, according to UniProt)
  • Structure

  • [PDB|3DL8] (structure of the ([protein|5350DC618130E013757EE667B9AFC5F2EC68EC08|SecY]-[protein|1007EA15FB7AF81A44400287DB68BCC497158ACF|SecE]-[protein|D8851F453E5EF18D36F25834A8CB9C61EAF15E44|SecG])-[protein|AD7CD451B4AE638A719C91780339784A7FF0F248|SecA] complex) [Pubmed|18923516]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|D8851F453E5EF18D36F25834A8CB9C61EAF15E44|secG]-[gene|C0B6520E74CE9F7EE3DEC8C0D83E0770F241C4E8|yvaK]-[gene|0472A4346ADA1DC41C9D00E8F3222A0EBB76DFA8|rnr]-[gene|D19519B5A776D6E8EC2BFE7A7D67469CA0A6459A|smpB]-[gene|5C12BB19B975F7FEBCFA119DAC66338C20FCECFA|ssrA]
    description
    [Pubmed|17369301]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • ''[protein|search|yvaK]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • BKE33630 (Δ[gene|D8851F453E5EF18D36F25834A8CB9C61EAF15E44|secG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCATACACCTCCAGAC, downstream forward: _UP4_TAGGGCAATGTTTGTATAAG
  • BKK33630 (Δ[gene|D8851F453E5EF18D36F25834A8CB9C61EAF15E44|secG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCATACACCTCCAGAC, downstream forward: _UP4_TAGGGCAATGTTTGTATAAG
  • References

    Reviews

  • 25212246,27890920
  • Original publications

  • 10074070,18923516,17369301,26747607