SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


ATP-binding A1 component of [SW|ECF transporter]s
31.31 kDa
protein length
281 aa Sequence Blast
gene length
846 bp Sequence Blast
uptake of micronutrients
[SW|ECF transporter] (ATP-binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.3|ECF transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.3|ECF transporter] → [category|SW|The general components of the ECF transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    150,443 → 151,288

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|5ABF4F7A3D00B523F67B281241A6A8101EC60057|YbaE]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 7-242) (according to UniProt)
  • Structure

  • [PDB|4HUQ] (EcfA1-EcfA2-EcfT-FolT complex of ''Lactobacillus brevis''), [Pubmed|23584589]
  • [SW|Localization]

  • membrane associated (via [protein|7DC7BD54ED425859FFD45B8B6F3522750A938835|YbaF]) [Pubmed|10092453]
  • Biological materials


  • BKE01450 (Δ[gene|D8637043C7E2291589C966E95F94DC61B1A8AB75|ybxA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAAAACCGGCCTCCTC, downstream forward: _UP4_AAGATGTAGAGCATCGCTAT
  • BKK01450 (Δ[gene|D8637043C7E2291589C966E95F94DC61B1A8AB75|ybxA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAAAACCGGCCTCCTC, downstream forward: _UP4_AAGATGTAGAGCATCGCTAT
  • BP1149 ([gene|D8637043C7E2291589C966E95F94DC61B1A8AB75|ybxA]-[gene|5ABF4F7A3D00B523F67B281241A6A8101EC60057|ybaE]-[gene|7DC7BD54ED425859FFD45B8B6F3522750A938835|ybaF]::cat trp+) available at [SW|Jörg Stülke]'s and [SW|Fabian Commichau]'s labs
  • References

  • 10092453,20497229,22574898,24362466