The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqjN

similar to amino acid degradation

locus: BSU_23810

pI: 5.18

mw: 61.67 kDa

protein length: 547 aa

gene length: 1644 bp

function: unknown

product: unknown

essential: no

synonyms

Genomic Context

categories

• [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
• [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]

Gene

Coordinates: 2,474,028 → 2,475,671

The protein

Paralogous protein(s)

• [protein|D8D79BC7E98754963CA9DC577B90929A5A9CE051|RocB]

[SW|Localization]

• cytoplasm (according to Swiss-Prot)

Expression and Regulation

Operons

• genes: [gene|D8607250EEE380DA8E1CC291B21D5626FA33313E|yqjN]
  description: [Pubmed|22383849]

  additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]

Biological materials

Mutant

• MGNA-C394 (yqjN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2392 NBRP B. subtilis, Japan]
• BKE23810 (Δ[gene|D8607250EEE380DA8E1CC291B21D5626FA33313E|yqjN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATTCCGCCCCTCCTA, downstream forward: _UP4_TAAAAAACAGAAGGCACTGT
• BKK23810 (Δ[gene|D8607250EEE380DA8E1CC291B21D5626FA33313E|yqjN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATTCCGCCCCTCCTA, downstream forward: _UP4_TAAAAAACAGAAGGCACTGT