SubtiBank SubtiBank
yqjN
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqjN

similar to amino acid degradation
locus
BSU_23810
pI
5.18
mw
61.67 kDa
protein length
547 aa Sequence Blast
gene length
1644 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,474,028 → 2,475,671

    The protein

    Paralogous protein(s)

  • [protein|D8D79BC7E98754963CA9DC577B90929A5A9CE051|RocB]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|D8607250EEE380DA8E1CC291B21D5626FA33313E|yqjN]
    description
    [Pubmed|22383849]

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C394 (yqjN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2392 NBRP B. subtilis, Japan]
  • BKE23810 (Δ[gene|D8607250EEE380DA8E1CC291B21D5626FA33313E|yqjN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATTCCGCCCCTCCTA, downstream forward: _UP4_TAAAAAACAGAAGGCACTGT
  • BKK23810 (Δ[gene|D8607250EEE380DA8E1CC291B21D5626FA33313E|yqjN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATTCCGCCCCTCCTA, downstream forward: _UP4_TAAAAAACAGAAGGCACTGT