SubtiBank SubtiBank
yqbN/2
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqbN/2

similar to phage-related protein, part of the yqbN pseudogene
locus
BSU_26040
pI
0.00
mw
0.00 kDa
protein length
146 aa Sequence Blast
gene length
438 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    2,677,657 → 2,678,094

    The protein

    Structure

  • [PDB|3KLU]
  • Biological materials

    Mutant

  • BKE26040 (Δ[gene|D85DA45241C084CCA762318F13E9A69F493B2C2B|yqbN/2]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATTAACTCCTTTT, downstream forward: _UP4_GATCTCGAAGACCTTGAAGA
  • BKK26040 (Δ[gene|D85DA45241C084CCA762318F13E9A69F493B2C2B|yqbN/2]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATTAACTCCTTTT, downstream forward: _UP4_GATCTCGAAGACCTTGAAGA