SubtiBank SubtiBank
yqbN/2
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqbN/2

similar to phage-related protein, part of the yqbN pseudogene
locus
BSU26040
pI
0.00
mw
0.00 kDa
protein length
146 aa Sequence Blast
gene length
438 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    2,677,657 → 2,678,094

    The protein

    Structure

  • [PDB|3KLU]
  • Biological materials

    Mutant

  • BKE26040 (Δ[gene|D85DA45241C084CCA762318F13E9A69F493B2C2B|yqbN/2]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATTAACTCCTTTT, downstream forward: _UP4_GATCTCGAAGACCTTGAAGA
  • BKK26040 (Δ[gene|D85DA45241C084CCA762318F13E9A69F493B2C2B|yqbN/2]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATTAACTCCTTTT, downstream forward: _UP4_GATCTCGAAGACCTTGAAGA