SubtiBank SubtiBank
yqcE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqcE

similar to phage-related protein
locus
BSU25930
pI
4.70
mw
6.13 kDa
protein length
gene length
165 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,666,884 → 2,667,048

    Biological materials

    Mutant

  • BKE25930 (Δ[gene|D84482C0742A93E797B8DA81CAABB80A31F4B8C2|yqcE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCATGAACCTTGCCCTCC, downstream forward: _UP4_TAGGGCTTTTTTATTTTTCC
  • BKK25930 (Δ[gene|D84482C0742A93E797B8DA81CAABB80A31F4B8C2|yqcE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCATGAACCTTGCCCTCC, downstream forward: _UP4_TAGGGCTTTTTTATTTTTCC