SubtiBank SubtiBank
yqcG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqcG

toxin, eliminates defective cells from developing biofilms, DNase activity
locus
BSU25860
pI
8.81
mw
59.50 kDa
protein length
531 aa Sequence Blast
gene length
1596 bp Sequence Blast
function
eliminates defective cells from developing biofilms
product
toxin
essential
yes
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.2|Type 2 TA systems]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,661,102 → 2,662,697

    The protein

    Catalyzed reaction/ biological activity

  • part of a type II toxin/antitoxin system (with [protein|1E12F7A40992AE240568A0E8A0EA4F6BBDECF142|YqcF]) [Pubmed|27450630]
  • eliminates defective cells from developing biofilms [Pubmed|27450630]
  • DNA degradation [Pubmed|25922388]
  • Protein family

  • UPF0720 family (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|D828A8E03C894D1082EFCB11BEF1384F04D17ECA|yqcG]-[gene|1E12F7A40992AE240568A0E8A0EA4F6BBDECF142|yqcF]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • BKE25860 (Δ[gene|D828A8E03C894D1082EFCB11BEF1384F04D17ECA|yqcG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCATATCCTTTCATT, downstream forward: _UP4_GGAGATTAAGGAGAGATTGT
  • BKK25860 (Δ[gene|D828A8E03C894D1082EFCB11BEF1384F04D17ECA|yqcG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCATATCCTTTCATT, downstream forward: _UP4_GGAGATTAAGGAGAGATTGT
  • References

  • 14651647,25922388,22200572,23033921,20817675,27450630