SubtiBank SubtiBank
yqcG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqcG

toxin, eliminates defective cells from developing biofilms, DNase activity
locus
BSU_25860
pI
8.81
mw
59.50 kDa
protein length
531 aa Sequence Blast
gene length
1596 bp Sequence Blast
function
eliminates defective cells from developing biofilms
product
toxin
essential
yes
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.2|Type 2 TA systems]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,661,102 → 2,662,697

    The protein

    Catalyzed reaction/ biological activity

  • part of a type II toxin/antitoxin system (with [protein|1E12F7A40992AE240568A0E8A0EA4F6BBDECF142|YqcF]) [Pubmed|27450630]
  • eliminates defective cells from developing biofilms [Pubmed|27450630]
  • DNA degradation [Pubmed|25922388]
  • [SW|Domains]

  • [SW|LXG domain] (aa 1-235) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|D828A8E03C894D1082EFCB11BEF1384F04D17ECA|yqcG]-[gene|1E12F7A40992AE240568A0E8A0EA4F6BBDECF142|yqcF]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • BKE25860 (Δ[gene|D828A8E03C894D1082EFCB11BEF1384F04D17ECA|yqcG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCATATCCTTTCATT, downstream forward: _UP4_GGAGATTAAGGAGAGATTGT
  • BKK25860 (Δ[gene|D828A8E03C894D1082EFCB11BEF1384F04D17ECA|yqcG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCATATCCTTTCATT, downstream forward: _UP4_GGAGATTAAGGAGAGATTGT
  • References

  • 14651647,25922388,22200572,23033921,20817675,27450630