SubtiBank SubtiBank


toxin, eliminates defective cells from developing biofilms, DNase activity
59.50 kDa
protein length
531 aa Sequence Blast
gene length
1596 bp Sequence Blast
eliminates defective cells from developing biofilms

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW|Type 2 TA systems]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    2,661,102 → 2,662,697

    The protein

    Catalyzed reaction/ biological activity

  • part of a type II toxin/antitoxin system (with [protein|1E12F7A40992AE240568A0E8A0EA4F6BBDECF142|YqcF]) [Pubmed|27450630]
  • eliminates defective cells from developing biofilms [Pubmed|27450630]
  • DNA degradation [Pubmed|25922388]
  • [SW|Domains]

  • [SW|LXG domain] (aa 1-235) (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials


  • BKE25860 (Δ[gene|D828A8E03C894D1082EFCB11BEF1384F04D17ECA|yqcG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCATATCCTTTCATT, downstream forward: _UP4_GGAGATTAAGGAGAGATTGT
  • BKK25860 (Δ[gene|D828A8E03C894D1082EFCB11BEF1384F04D17ECA|yqcG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCATATCCTTTCATT, downstream forward: _UP4_GGAGATTAAGGAGAGATTGT
  • References

  • 14651647,25922388,22200572,23033921,20817675,27450630