The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqcG

toxin, eliminates defective cells from developing biofilms, DNase activity

locus: BSU_25860

pI: 8.81

mw: 59.50 kDa

protein length: 531 aa

gene length: 1596 bp

function: eliminates defective cells from developing biofilms

product: toxin

essential: yes

synonyms

Genomic Context

categories

• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.2|Type 2 TA systems]
• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
• [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]

Gene

Coordinates: 2,661,102 → 2,662,697

The protein

Catalyzed reaction/ biological activity

• part of a type II toxin/antitoxin system (with [protein|1E12F7A40992AE240568A0E8A0EA4F6BBDECF142|YqcF]) [Pubmed|27450630]
• eliminates defective cells from developing biofilms [Pubmed|27450630]
• DNA degradation [Pubmed|25922388]

[SW|Domains]

• [SW|LXG domain] (aa 1-235) (according to UniProt)

Expression and Regulation

Operons

• genes: [gene|D828A8E03C894D1082EFCB11BEF1384F04D17ECA|yqcG]-[gene|1E12F7A40992AE240568A0E8A0EA4F6BBDECF142|yqcF]
  description: [Pubmed|22383849]

  regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]

  regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]

Biological materials

Mutant

• BKE25860 (Δ[gene|D828A8E03C894D1082EFCB11BEF1384F04D17ECA|yqcG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCATATCCTTTCATT, downstream forward: _UP4_GGAGATTAAGGAGAGATTGT
• BKK25860 (Δ[gene|D828A8E03C894D1082EFCB11BEF1384F04D17ECA|yqcG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCATATCCTTTCATT, downstream forward: _UP4_GGAGATTAAGGAGAGATTGT

References

• 14651647,25922388,22200572,23033921,20817675,27450630