SubtiBank SubtiBank
adaB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

adaB

O6-methylguanine-DNA methyltransferase
locus
BSU_01820
pI
6.15
mw
19.98 kDa
protein length
179 aa Sequence Blast
gene length
540 bp Sequence Blast
function
adaptive response to alkylative DNA damage
product
O6-methylguanine-DNA methyltransferase
essential
no
ec
2.1.1.63
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • Gene

    Coordinates
    204,351 → 204,890

    The protein

    Catalyzed reaction/ biological activity

  • 6-O-methyl-2'-deoxyguanosine in DNA + L-cysteinyl-[protein] --> 2'-deoxyguanosine in DNA + S-methyl-L-cysteinyl-[protein] (according to UniProt)
  • 4-O-methyl-thymidine in DNA + L-cysteinyl-[protein] --> thymidine in DNA + S-methyl-L-cysteinyl-[protein] (according to UniProt)
  • Protein family

  • MGMT family (with [protein|9492D341F54BE019B21C0BAF7465AD8F84CC6F23|Ogt], according to UniProt)
  • Structure

  • [PDB|4BHB] (from Mycobacterium tuberculosis, 42% identity) [pubmed|23564173]
  • Expression and Regulation

    Operons

    genes
    [gene|0F8A564256A598DB3A36668FA0C984542FE1323F|adaA]-[gene|D7E4E4A95CFDB3CFCC7432B08653644AF6876CA1|adaB]
    description
    [Pubmed|2120677]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2120677], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|0F8A564256A598DB3A36668FA0C984542FE1323F|AdaA]: positive regulation, in [regulon|0F8A564256A598DB3A36668FA0C984542FE1323F|AdaA regulon]
  • regulation

  • positive control by [protein|search|AdaA] [Pubmed|2120677]
  • view in new tab

    Biological materials

    Mutant

  • BKE01820 (Δ[gene|D7E4E4A95CFDB3CFCC7432B08653644AF6876CA1|adaB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAGTAAAGACCAATAAAGGG, downstream forward: _UP4_TGAAAGTGAATCATCTATAA
  • BKK01820 (Δ[gene|D7E4E4A95CFDB3CFCC7432B08653644AF6876CA1|adaB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAGTAAAGACCAATAAAGGG, downstream forward: _UP4_TGAAAGTGAATCATCTATAA
  • References

    Reviews

  • 22933559,24810496
  • Original publications

  • 2120677,23564173