SubtiBank SubtiBank
yqjL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqjL

general stress protein, putative hydrolase involved in oxidative stress resistance, important for survival at low temperature
locus
BSU_23830
pI
6.56
mw
28.02 kDa
protein length
253 aa Sequence Blast
gene length
762 bp Sequence Blast
function
resistence against paraquat
product
putative hydrolase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,476,969 → 2,477,730

    Expression and Regulation

    Operons

    genes
    [gene|D7C7840B3ED780666AB05ED163DA371DFB78E15B|yqjL]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|12207695], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]: sigma factor, in [regulon|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV regulon]
  • regulation

  • expression is reduced in a [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV] mutant [Pubmed|21926231]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C393 (yqjL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2391 NBRP B. subtilis, Japan]
  • BKE23830 (Δ[gene|D7C7840B3ED780666AB05ED163DA371DFB78E15B|yqjL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGAGTCATCTCCTCTA, downstream forward: _UP4_TAACGTAAAAAAAGACCGGG
  • BKK23830 (Δ[gene|D7C7840B3ED780666AB05ED163DA371DFB78E15B|yqjL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGAGTCATCTCCTCTA, downstream forward: _UP4_TAACGTAAAAAAAGACCGGG
  • References

  • 15838020,12207695,15805528