SubtiBank SubtiBank
dck
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

dck

deoxyadenosin/deoxycytidine kinase
locus
BSU_00140
pI
5.54
mw
25.30 kDa
protein length
217 aa Sequence Blast
gene length
654 bp Sequence Blast
function
purine salvage and interconversion
product
deoxyadenosin/deoxycytidine kinase
essential
no
synonyms
yaaF

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.3|Purine salvage and interconversion]
  • Gene

    Coordinates
    22,496 → 23,149

    The protein

    Catalyzed reaction/ biological activity

  • ATP + deoxyadenosine --> ADP + dAMP (accoding to UniProt)
  • NTP + deoxycytidine --> NDP + dCMP (accoding to UniProt)
  • Protein family

  • DCK/DGK family (together woth [protein|0DA340B3D23B63C6BD284BF86409558A31B12B53|Dgk]) (accoding to UniProt)
  • Paralogous protein(s)

  • [protein|0DA340B3D23B63C6BD284BF86409558A31B12B53|Dgk]
  • Structure

  • [PDB|2JAQ] (DAK from Mycoplasma mycoides, 35% identity) [pubmed|17229440]
  • [SW|Localization]

  • cytoplasm (accoding to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|0DA340B3D23B63C6BD284BF86409558A31B12B53|dgk]-[gene|D749382783437F40AE1C66755F57D44E3FCA193F|dck]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B887 (yaaF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1886 NBRP B. subtilis, Japan]
  • BKE00140 (Δ[gene|D749382783437F40AE1C66755F57D44E3FCA193F|dck]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCTTAGGGATATGATGTT, downstream forward: _UP4_TGAATCTCAGTCGAGATTCA
  • BKK00140 (Δ[gene|D749382783437F40AE1C66755F57D44E3FCA193F|dck]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCTTAGGGATATGATGTT, downstream forward: _UP4_TGAATCTCAGTCGAGATTCA
  • References

  • 6251049,11078735,17229440