SubtiBank SubtiBank
rpmGA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rpmGA

ribosomal protein L33a
locus
BSU_24900
pI
10.44
mw
5.85 kDa
protein length
gene length
150 bp Sequence Blast
function
translation
product
ribosomal protein L33a
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    2,574,408 → 2,574,557

    The protein

    Protein family

  • bacterial [SW|ribosomal protein] bL33 family (with [protein|BBD82B93D5E880AB7093ED53DDB149B0E0B3BAE4|RpmGB] and [protein|5189DF2F6144CD2429B5C01B1AD03BAE98307579|RpmGC], according to UniProt)
  • Paralogous protein(s)

  • [protein|BBD82B93D5E880AB7093ED53DDB149B0E0B3BAE4|RpmGB], [protein|5189DF2F6144CD2429B5C01B1AD03BAE98307579|RpmGC]
  • Modification

  • phosphorylated on Arg-29 [Pubmed|22517742]
  • [SW|Cofactors]

  • requires zinc for activity [Pubmed|19648245]
  • Structure

  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • [SW|Localization]

  • [SW|ribosome] (according to UniProt)
  • Additional information

  • the protein is significantly underrepresented in 45S assembly intermediates that accumulate upon depletion of [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|RbgA] [Pubmed|24335279,23700310]
  • Expression and Regulation

    Operons

    genes
    [gene|D73FC9CAD929919050837824B4794F9FC9E83052|rpmGA]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|402CD558623D1D520D3401F03CF021F42B3894A9|yqgL]-[gene|52BD8C536202E6D0B2B1F13E677CB2534F80BCEF|yqgM]-[gene|D73FC9CAD929919050837824B4794F9FC9E83052|rpmGA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE24900 (Δ[gene|D73FC9CAD929919050837824B4794F9FC9E83052|rpmGA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTTCCCTCCAAACT, downstream forward: _UP4_TAACAGCTTTGCTGTTTGAG
  • BKK24900 (Δ[gene|D73FC9CAD929919050837824B4794F9FC9E83052|rpmGA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTTCCCTCCAAACT, downstream forward: _UP4_TAACAGCTTTGCTGTTTGAG
  • References

  • 19648245,22517742,23002217,24335279,23700310,25903689