SubtiBank SubtiBank
rpmGA

rpmGA

ribosomal protein L33a
locus
BSU_24900
pI
10.44
mw
5.85 kDa
protein length
gene length
150 bp Sequence Blast
function
translation
product
ribosomal protein L33a
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    2,574,408 → 2,574,557

    The protein

    Protein family

  • bacterial [SW|ribosomal protein] bL33 family (with [protein|BBD82B93D5E880AB7093ED53DDB149B0E0B3BAE4|RpmGB] and [protein|5189DF2F6144CD2429B5C01B1AD03BAE98307579|RpmGC], according to UniProt)
  • Paralogous protein(s)

  • [protein|BBD82B93D5E880AB7093ED53DDB149B0E0B3BAE4|RpmGB], [protein|5189DF2F6144CD2429B5C01B1AD03BAE98307579|RpmGC]
  • Modification

  • phosphorylated on Arg-29 [Pubmed|22517742]
  • [SW|Cofactors]

  • requires zinc for activity [Pubmed|19648245]
  • Structure

  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • [SW|Localization]

  • [SW|ribosome] (according to UniProt)
  • Additional information

  • the protein is significantly underrepresented in 45S assembly intermediates that accumulate upon depletion of [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|RbgA] [Pubmed|24335279,23700310]
  • Expression and Regulation

    Operons

    genes
    [gene|D73FC9CAD929919050837824B4794F9FC9E83052|rpmGA]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|402CD558623D1D520D3401F03CF021F42B3894A9|yqgL]-[gene|52BD8C536202E6D0B2B1F13E677CB2534F80BCEF|yqgM]-[gene|D73FC9CAD929919050837824B4794F9FC9E83052|rpmGA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE24900 (Δ[gene|D73FC9CAD929919050837824B4794F9FC9E83052|rpmGA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTTCCCTCCAAACT, downstream forward: _UP4_TAACAGCTTTGCTGTTTGAG
  • BKK24900 (Δ[gene|D73FC9CAD929919050837824B4794F9FC9E83052|rpmGA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTTCCCTCCAAACT, downstream forward: _UP4_TAACAGCTTTGCTGTTTGAG
  • References

  • 19648245,22517742,23002217,24335279,23700310,25903689