SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional repressor ([SW|Lrp family]) of the [gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]-[gene|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]-[gene|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]-[gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ]-[gene|17FFEA4977F4F7334CFF7CD1C644DF14F599E6E6|yrdK] operon
17.32 kDa
protein length
157 aa Sequence Blast
gene length
474 bp Sequence Blast
regulation of branched-chain amino acid transport
transcriptional repressor ([SW|Lrp family])

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of branched-chain amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of branched-chain amino acids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    2,729,753 → 2,730,226

    The protein

    Protein family

  • [SW|Lrp family]
  • Structure

  • [PDB|2GQQ] (E. coli Lrp, 34% identity) [pubmed|17223133]
  • Expression and Regulation



    regulatory mechanism

  • [protein|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|AzlB]: repression, [Pubmed|9287000], in [regulon|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|AzlB regulon]
  • regulation

  • repressed by [protein|search|AzlB] [Pubmed|9287000]
  • view in new tab

    Biological materials


  • BKE26720 (Δ[gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCACAACCCCCAATAC, downstream forward: _UP4_GATGAAATGTAGGAGGTTGT
  • BKK26720 (Δ[gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCACAACCCCCAATAC, downstream forward: _UP4_GATGAAATGTAGGAGGTTGT
  • References

  • 9287000,17223133