SubtiBank SubtiBank
mdxG [2019-06-06 10:11:55]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

mdxG [2019-06-06 10:11:55]

maltodextrin [SW|ABC transporter], permease
30.73 kDa
protein length
278 aa Sequence Blast
gene length
837 bp Sequence Blast
maltodextrin utilization
maltodextrin [SW|ABC transporter], permease

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of starch/ maltodextrin]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,552,369 → 3,553,205

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|676932E7DF143DC9AAAF1F415FB3D14EE25B2C2F|GanQ]
  • Structure

  • [PDB|2R6G] (from E. coli, 34% identity) [pubmed|18033289]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation




  • induced in the presence of maltose [Pubmed|9573215]
  • view in new tab

    Biological materials


  • MGNA-B625 (yvdI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34590 (Δ[gene|D72CFFE8ED3EC0280AE92C05A136D66ED1F62251|mdxG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGGCAGTGCTCGCGT, downstream forward: _UP4_GGCGGAACAAAGGGGTAATG
  • BKK34590 (Δ[gene|D72CFFE8ED3EC0280AE92C05A136D66ED1F62251|mdxG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGGCAGTGCTCGCGT, downstream forward: _UP4_GGCGGAACAAAGGGGTAATG
  • References

  • 10092453,16707683,18033289