SubtiBank SubtiBank
gerBB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gerBB

nutrient receptor, germination response to the combination of glucose, fructose, and KCl
locus
BSU_35810
pI
9.89
mw
41.55 kDa
protein length
368 aa Sequence Blast
gene length
1107 bp Sequence Blast
function
germination
product
nutrient receptor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.1|Germinant receptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,690,269 → 3,691,375

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • [SW|Spore germination protein (SGP) (TC 2.A.3.9) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|5FF739B8C087207039BB6DC293EE77F59337ED0B|GerAB], [protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|YndE], [protein|D1AFCB1BE693AB6B8461B7764B6641E6EB1404FA|GerKB]
  • [SW|Localization]

  • spore inner membrane [Pubmed|21696470]
  • Expression and Regulation

    Operons

    genes
    [gene|3368743E6E03792DB83A38A19989123304DF7560|gerBA]-[gene|D70EC7C02BC79BED724489ABCB6356447F215B87|gerBB]-[gene|93D4D6864686E6E559E6CEFA69BAC77EEFAA1BE3|gerBC]
    description
    [Pubmed|8012571]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,8012571], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,8012571]
  • additional information

  • 700 molecules are present per spore [PubMed|23749970]
  • view in new tab

    Biological materials

    Mutant

  • BKE35810 (Δ[gene|D70EC7C02BC79BED724489ABCB6356447F215B87|gerBB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGCTCTGATTTCCTCATAG, downstream forward: _UP4_AAAATAGGGAGGGGGCAGCT
  • BKK35810 (Δ[gene|D70EC7C02BC79BED724489ABCB6356447F215B87|gerBB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGCTCTGATTTCCTCATAG, downstream forward: _UP4_AAAATAGGGAGGGGGCAGCT
  • References

  • 10348844,12670969,15774895,7812448,8012571,16352818,21696470,23396907