SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to endo-1,4-beta-glucanase
39.06 kDa
protein length
361 aa Sequence Blast
gene length
1086 bp Sequence Blast

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of other polymeric carbohydrates]
  • Gene

    2,950,221 → 2,951,306

    The protein

    Protein family

  • Peptidase M42 family (with [protein|EDD5ACB89661D3B6D77057863EF345EBF84F49B2|YhfE] and [protein|16585F4118F3D2732D6780D351B7AA5F6DDCCEB8|YtoP], according to UniProt)
  • Paralogous protein(s)

  • [protein|16585F4118F3D2732D6780D351B7AA5F6DDCCEB8|YtoP]
  • Structure

  • [PDB|1VHE]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A999 (ysdC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE28820 (Δ[gene|D6F5F7C1C699C674FA7AC09A020E8E2F571E1AA9|ysdC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCCAAACCCTCCTTC, downstream forward: _UP4_TAAAGATACGGAAGAATCCG
  • BKK28820 (Δ[gene|D6F5F7C1C699C674FA7AC09A020E8E2F571E1AA9|ysdC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCCAAACCCTCCTTC, downstream forward: _UP4_TAAAGATACGGAAGAATCCG
  • References

  • 15378759