SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


GTPase activating protein, activates FlhF, activates assembly of the flagellar C ring, control of flagellar basal body position
33.01 kDa
protein length
298 aa Sequence Blast
gene length
897 bp Sequence Blast
activation of FlhF
GTPase activating protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Motility and chemotaxis/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.4|Swarming]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • Gene

    1,710,838 → 1,711,734

    Phenotypes of a mutant

  • susceptible to acriflavine and ethidium bromide, and severe growth inhibition as surfactin concentration increased up to 100ug/ml.
  • The protein

    Catalyzed reaction/ biological activity

  • binds [protein|BB6F5D7463EF96E2C6344D0BC30A227C5E3B5817|FlhF] and stimulates its GTPase activity [Pubmed|22056770]
  • controls the distance between the flagellar bodies [Pubmed|23190039]
  • Protein family

  • ParA family (with [protein|37DAD42A391E2FC506225EAF91B8F21629A401DF|MinD] and [protein|5B3DB5A796ACA48390278E60478DFF13D0074A8D|ParA], according to UniProt)
  • Structure

  • [PDB|4RZ3] (from ''Geobacillus thermodenitrificans'') [Pubmed|25733861]
  • [PDB|3SYN] (complex with [protein|BB6F5D7463EF96E2C6344D0BC30A227C5E3B5817|FlhF]) [Pubmed|22056770]
  • [SW|Localization]

  • cytoplasm (homogeneous) and flagellar basal body [Pubmed|25733861,16479537]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|20233303], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: regulation, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • regulation

  • see [SW|fla-che operon]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9657996], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • BKE16410 (Δ[gene|D6D34E68FB3BAAACB533F98290FD363A5B00B2C6|flhG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTTGCTGCTTGGTCATATC, downstream forward: _UP4_TCTTTTTTAATGAGGAGGGC
  • BKK16410 (Δ[gene|D6D34E68FB3BAAACB533F98290FD363A5B00B2C6|flhG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTTGCTGCTTGGTCATATC, downstream forward: _UP4_TCTTTTTTAATGAGGAGGGC
  • References


  • 26195616
  • Original Publications

  • 15066026,17850253,14651647,16479537,9657996,8157612,15175317,22056770,23190039,24386445,25733861