SubtiBank SubtiBank
rsgI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rsgI

regulator of [protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI] activity
locus
BSU13460
pI
4.52
mw
43.43 kDa
protein length
381 aa Sequence Blast
gene length
1146 bp Sequence Blast
function
control of [protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI] activity
product
anti-[SW|sigma factor]
essential
no
synonyms
ykrI

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,412,644 → 1,413,789

    Phenotypes of a mutant

  • suppresses the growth defect of a ''[gene|6ED386D49F973C1F6B1076974F54275DD583C9D3|mbl]'' mutation [Pubmed|19114499]
  • The protein

    Catalyzed reaction/ biological activity

  • anti-sigma factor for [protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI] [Pubmed|17185538]
  • [SW|Localization]

  • membrane [Pubmed|17185538]
  • Expression and Regulation

    Operons

    genes
    [gene|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI]-[gene|D6C2B8ABBBD1F9F2D36C34098D5B811A15C60D3B|rsgI]
    description
    [Pubmed|17185538]

    sigma factors

  • [protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI]: sigma factor, [Pubmed|17185538], in [regulon|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|23199363], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: activation, [Pubmed|24125693,23199363], in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • regulation

  • induced at high temperature ([protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI], [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]) [Pubmed|23199363,17185538]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A781 (ykrI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/781 NBRP B. subtilis, Japan]
  • BKE13460 (Δ[gene|D6C2B8ABBBD1F9F2D36C34098D5B811A15C60D3B|rsgI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTCATGAGTGCAGCACCCC, downstream forward: _UP4_GCCCCCGGCGAATAAAGACC
  • BKK13460 (Δ[gene|D6C2B8ABBBD1F9F2D36C34098D5B811A15C60D3B|rsgI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTCATGAGTGCAGCACCCC, downstream forward: _UP4_GCCCCCGGCGAATAAAGACC
  • References

  • 17185538,23199363,17185538,19114499,28333276,29914988