SubtiBank SubtiBank
ywaF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywaF

unknown
locus
BSU_38440
pI
9.85
mw
27.15 kDa
protein length
237 aa Sequence Blast
gene length
714 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ipa-11d

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,945,530 → 3,946,243

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-B677 (ywaF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1676 NBRP B. subtilis, Japan]
  • BKE38440 (Δ[gene|D6797E1B54F91A3DBD1E9CB2312CAD2405E8CEA4|ywaF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACTGCACCCCCGTTTT, downstream forward: _UP4_TGACACCTTTTTTGTTGTAT
  • BKK38440 (Δ[gene|D6797E1B54F91A3DBD1E9CB2312CAD2405E8CEA4|ywaF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACTGCACCCCCGTTTT, downstream forward: _UP4_TGACACCTTTTTTGTTGTAT