SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


62.30 kDa
protein length
546 aa Sequence Blast
gene length
1641 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,912,953 → 1,914,593

    The protein


  • membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B110 (yndJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE17800 (Δ[gene|D5FE7BD56C10CD05B90DB3EDA0622D1982B38F68|yndJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCACTGACTATGCCATTTC, downstream forward: _UP4_TAACACAAAGAAGAAGCTTC
  • BKK17800 (Δ[gene|D5FE7BD56C10CD05B90DB3EDA0622D1982B38F68|yndJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCACTGACTATGCCATTTC, downstream forward: _UP4_TAACACAAAGAAGAAGCTTC