SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


bacillopeptidase F
154.34 kDa
protein length
1433 aa Sequence Blast
gene length
4302 bp Sequence Blast
protein degradation
bacillopeptidase F

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of proteins]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Extracellular feeding proteases]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    1,599,283 → 1,603,584

    The protein

    Protein family

  • [SW|peptidase S8 family] (according to UniProt)
  • [SW|Domains]

  • Inhibitor I9 domain (aa 68-177) (according to UniProt)
  • Peptidase S8 domain (aa 200-512) (according to UniProt)
  • [SW|Localization]

  • secreted (according to Swiss-Prot), extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P [Pubmed|18194340], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • repressed by glucose (7.7-fold) [Pubmed|12850135]
  • view in new tab

    Biological materials


  • KO7 (''ΔnprE ΔaprE Δepr Δmpr ΔnprB Δvpr Δbpr''), available as BGSC 1A1133
  • BKE15300 (Δ[gene|D5EBF5881EB3F89C9098DDE6EF18C8EBB02A278C|bpr]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCCCCCTTTTTC, downstream forward: _UP4_TAAGTGGAAAAAAAGCTGCC
  • BKK15300 (Δ[gene|D5EBF5881EB3F89C9098DDE6EF18C8EBB02A278C|bpr]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCCCCCTTTTTC, downstream forward: _UP4_TAAGTGGAAAAAAAGCTGCC
  • References


  • 20735481
  • Original publications

  • 2106512,18414485,18194340,24149708,18957862,12850135,24115457