SubtiBank SubtiBank
gerKC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gerKC

nutrient receptor
locus
BSU03710
pI
9.04
mw
45.67 kDa
protein length
407 aa Sequence Blast
gene length
1224 bp Sequence Blast
function
germination
product
nutrient receptor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.1|Germinant receptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    421,734 → 422,957

    The protein

    Protein family

  • gerABKC lipoprotein family (according to Swiss-Prot)
  • [SW|Localization]

  • spore inner membrane [Pubmed|21696470]
  • Expression and Regulation

    Operons

    genes
    [gene|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|gerKA]-[gene|D5D4E1E182F972BEF6BB432A7FF25EF45F1F0D95|gerKC]-[gene|D1AFCB1BE693AB6B8461B7764B6641E6EB1404FA|gerKB]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16707705], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, [Pubmed|16707705], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed during sporulation ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG], [SW|SpoVT]) [Pubmed|16707705]
  • additional information

  • 700 molecules are present per spore [PubMed|23749970]
  • view in new tab

    Biological materials

    Mutant

  • BKE03710 (Δ[gene|D5D4E1E182F972BEF6BB432A7FF25EF45F1F0D95|gerKC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGCATGAGAACGGCTAATA, downstream forward: _UP4_TAGGTCTGAAGAAAGGGGAA
  • BKK03710 (Δ[gene|D5D4E1E182F972BEF6BB432A7FF25EF45F1F0D95|gerKC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGCATGAGAACGGCTAATA, downstream forward: _UP4_TAGGTCTGAAGAAAGGGGAA
  • References

  • 16707705,21696470,16352818,23396907,24752279,22343299,16740944,26731423