SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


nutrient receptor
45.67 kDa
protein length
407 aa Sequence Blast
gene length
1224 bp Sequence Blast
nutrient receptor

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW|Germinant receptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    421,734 → 422,957

    The protein

    Protein family

  • [SW|GerABKC lipoprotein family] (according to UniProt)
  • [SW|Localization]

  • spore inner membrane [Pubmed|21696470]
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16707705], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, [Pubmed|16707705], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed during sporulation ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG], [SW|SpoVT]) [Pubmed|16707705]
  • additional information

  • 700 molecules are present per spore [PubMed|23749970]
  • view in new tab

    Biological materials


  • BKE03710 (Δ[gene|D5D4E1E182F972BEF6BB432A7FF25EF45F1F0D95|gerKC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGCATGAGAACGGCTAATA, downstream forward: _UP4_TAGGTCTGAAGAAAGGGGAA
  • BKK03710 (Δ[gene|D5D4E1E182F972BEF6BB432A7FF25EF45F1F0D95|gerKC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGCATGAGAACGGCTAATA, downstream forward: _UP4_TAGGTCTGAAGAAAGGGGAA
  • References

  • 16707705,21696470,16352818,23396907,24752279,22343299,16740944,26731423