SubtiBank SubtiBank
ytrH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytrH

sporulation protein
locus
BSU_29239
pI
5.00
mw
12.00 kDa
protein length
113 aa Sequence Blast
gene length
342 bp Sequence Blast
function
unknown
product
sporulation protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,994,756 → 2,995,097

    Phenotypes of a mutant

  • inactivation of ''[gene|D5B9ACB1E447A893C99A4ACE1DA95EB38BCF971B|ytrH]'' reduces sporulation efficiency to 17.2% that of wild type cells [Pubmed|26735940]
  • Expression and Regulation

    Operons

    genes
    [gene|D5B9ACB1E447A893C99A4ACE1DA95EB38BCF971B|ytrH]-[gene|BB0443D95581DCA66EDA390842945F105A71A371|ytrI]
    description
    [Pubmed|12662922]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|12662922]
  • view in new tab

    Biological materials

    Mutant

  • BKE29239 (Δ[gene|D5B9ACB1E447A893C99A4ACE1DA95EB38BCF971B|ytrH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29239 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTATCACCTCACCTT, downstream forward: _UP4_CTGACCCAGGAGCATCTTTC
  • BKK29239 (Δ[gene|D5B9ACB1E447A893C99A4ACE1DA95EB38BCF971B|ytrH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29239 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTATCACCTCACCTT, downstream forward: _UP4_CTGACCCAGGAGCATCTTTC
  • References

  • 12662922,15547282,26735940