SubtiBank SubtiBank
pyrAB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pyrAB

carbamoyl-phosphate synthetase (catalytic subunit)
locus
BSU15520
pI
4.78
mw
117.44 kDa
protein length
1071 aa Sequence Blast
gene length
3216 bp Sequence Blast
function
pyrimidine biosynthesis
product
carbamoyl-phosphate synthetase (catalytic subunit)
essential
no
ec
6.3.5.5
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.4|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,623,736 → 1,626,951

    The protein

    Catalyzed reaction/ biological activity

  • 2 ATP L-glutamine HCO3- H2O = 2 ADP phosphate L-glutamate carbamoyl phosphate (according to Swiss-Prot)
  • Protein family

  • carB family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|7E6386F1949A6F46E4332BAB8F803742EB076AF0|CarB]
  • Structure

  • [PDB|1JDB] (from ''Escherichia coli'', 49% identity, 69% similarity) [Pubmed|10089390]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]-[gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]-[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]-[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]-[gene|E7741ED6F15044900BDC5F0584246469D2D4D586|pyrAA]-[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]-[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]-[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]-[gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]-[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]
    description
    [Pubmed|8206849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1709162], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR]: termination/ antitermination, via [SW|RNA switch], in [regulon|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR regulon]
  • regulation

  • induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
  • view in new tab

    Biological materials

    Mutant

  • BKE15520 (Δ[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTACTAAAATTTTGTTAA, downstream forward: _UP4_AATCAGGAGGCGGCAGTCAC
  • BKK15520 (Δ[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTACTAAAATTTTGTTAA, downstream forward: _UP4_AATCAGGAGGCGGCAGTCAC
  • References

    Reviews

  • 12859215,11395405,11163353
  • Original publications

  • 8206849,1709162,18763711,10089390,8663035