SubtiBank SubtiBank


carbamoyl-phosphate synthetase (catalytic subunit)
117.44 kDa
protein length
1071 aa Sequence Blast
gene length
3216 bp Sequence Blast
pyrimidine biosynthesis
carbamoyl-phosphate synthetase (catalytic subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,623,736 → 1,626,951

    The protein

    Catalyzed reaction/ biological activity

  • 2 ATP + H2O + hydrogencarbonate + L-glutamine --> 2 ADP + carbamoyl phosphate + 2 H+ + L-glutamate + phosphate (according to UniProt)
  • Protein family

  • carB family (with [protein|7E6386F1949A6F46E4332BAB8F803742EB076AF0|CarB], according to UniProt)
  • Paralogous protein(s)

  • [protein|7E6386F1949A6F46E4332BAB8F803742EB076AF0|CarB]
  • [SW|Domains]

  • 2 [SW|ATP-grasp domain]s (aa 133-327, aa 671-861) (according to UniProt)
  • MGS-like domain (aa 930-1071) (according to UniProt)
  • Structure

  • [PDB|1JDB] (from ''Escherichia coli'', 49% identity, 69% similarity) [Pubmed|10089390]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1709162], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR]: termination/ antitermination, via [SW|RNA switch], in [regulon|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR regulon]
  • regulation

  • induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
  • view in new tab

    Biological materials


  • BKE15520 (Δ[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTACTAAAATTTTGTTAA, downstream forward: _UP4_AATCAGGAGGCGGCAGTCAC
  • BKK15520 (Δ[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTACTAAAATTTTGTTAA, downstream forward: _UP4_AATCAGGAGGCGGCAGTCAC
  • References


  • 12859215,11395405,11163353
  • Original publications

  • 8206849,1709162,18763711,10089390,8663035