SubtiBank SubtiBank
yacC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yacC

similar to chaperonin (HSP33 Homolog), putative disulfide bond chaperone
locus
BSU_00710
pI
4.66
mw
31.66 kDa
protein length
291 aa Sequence Blast
gene length
876 bp Sequence Blast
function
unknown
product
putative disulfide bond chaperone
essential
no
synonyms
hslO

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.3|Chaperone/ protein folding/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    79,880 → 80,755

    The protein

    Protein family

  • HSP33 family (single member, according to UniProt)
  • Structure

  • [PDB|1VZY]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|9B8EAD4EDDA97526D4462F6F3205F81FECD039DE|coaX]-[gene|D579A7E4D8C3DEE4F85586C5F721CAD5FE2BCA75|yacC]-[gene|548926987569033AA0C40610B8E80FB2BB8E1E3A|yacD]-[gene|D1FC976597E5583E40A4ED7234FBCA743AB01354|cysK]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [pubmed|30480837], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • induced by heat stress ([protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]) [pubmed|30480837]
  • view in new tab

    genes
    [gene|9B8EAD4EDDA97526D4462F6F3205F81FECD039DE|coaX]-[gene|D579A7E4D8C3DEE4F85586C5F721CAD5FE2BCA75|yacC]
    description
    [Pubmed|18179421]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B924 (yacC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1923 NBRP B. subtilis, Japan]
  • BKE00710 (Δ[gene|D579A7E4D8C3DEE4F85586C5F721CAD5FE2BCA75|yacC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAATAATCCATTACTAAAC, downstream forward: _UP4_TAAGCTCTTTAGCGGGTTTT
  • BKK00710 (Δ[gene|D579A7E4D8C3DEE4F85586C5F721CAD5FE2BCA75|yacC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAATAATCCATTACTAAAC, downstream forward: _UP4_TAAGCTCTTTAGCGGGTTTT
  • References

    Research papers

  • 28516784,30480837