SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to chaperonin (HSP33 Homolog), putative disulfide bond chaperone
31.66 kDa
protein length
291 aa Sequence Blast
gene length
876 bp Sequence Blast
putative disulfide bond chaperone

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.3|Chaperone/ protein folding/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    79,880 → 80,755

    The protein

    Protein family

  • HSP33 family (single member, according to UniProt)
  • Structure

  • [PDB|1VZY]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [pubmed|30480837], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • induced by heat stress ([protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]) [pubmed|30480837]
  • view in new tab


    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • view in new tab

    Biological materials


  • MGNA-B924 (yacC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE00710 (Δ[gene|D579A7E4D8C3DEE4F85586C5F721CAD5FE2BCA75|yacC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAATAATCCATTACTAAAC, downstream forward: _UP4_TAAGCTCTTTAGCGGGTTTT
  • BKK00710 (Δ[gene|D579A7E4D8C3DEE4F85586C5F721CAD5FE2BCA75|yacC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAATAATCCATTACTAAAC, downstream forward: _UP4_TAAGCTCTTTAGCGGGTTTT
  • References

    Research papers

  • 28516784,30480837