SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


similar to chaperonin (HSP33 Homolog), putative disulfide bond chaperone
31.66 kDa
protein length
291 aa Sequence Blast
gene length
876 bp Sequence Blast
putative disulfide bond chaperone

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.3|Chaperone/ protein folding/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    79,880 → 80,755

    The protein

    Protein family

  • HSP33 family (single member, according to UniProt)
  • Structure

  • [PDB|1VZY]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [pubmed|30480837], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • induced by heat stress ([protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]) [pubmed|30480837]
  • view in new tab


    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • view in new tab

    Biological materials


  • MGNA-B924 (yacC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE00710 (Δ[gene|D579A7E4D8C3DEE4F85586C5F721CAD5FE2BCA75|yacC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAATAATCCATTACTAAAC, downstream forward: _UP4_TAAGCTCTTTAGCGGGTTTT
  • BKK00710 (Δ[gene|D579A7E4D8C3DEE4F85586C5F721CAD5FE2BCA75|yacC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAATAATCCATTACTAAAC, downstream forward: _UP4_TAAGCTCTTTAGCGGGTTTT
  • References

    Research papers

  • 28516784,30480837