SubtiBank SubtiBank
cwlH [2017-10-19 17:33:35]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

cwlH [2017-10-19 17:33:35]

N-acetylmuramoyl-L-alanine amidase
27.42 kDa
protein length
250 aa Sequence Blast
gene length
750 bp Sequence Blast
cell wall metabolism
N-acetylmuramoyl-L-alanine amidase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Autolysis]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    2,648,903 → 2,649,655

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolyzes the link between N-acetylmuramoyl residues and L-amino acid residues in certain cell-wall glycopeptides (according to Swiss-Prot)
  • Protein family

  • N-acetylmuramoyl-L-alanine amidase 2 family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|C9C395A5F6A2C06EAC97F228C5C66D1628C937CF|CwlA], [protein|50D7B97E4D3D41F74EF1942B85DE1DA4A33BEBB0|XlyA], [protein|A8AF827637B7208DFA101C9A2911BF9AB1AED08F|XlyB]
  • [SW|Domains]

  • contains an amidase_2 domain (like [protein|C1EB8D05386C1B35B8002239F5247CC6AB25F786|BlyA], [protein|C9C395A5F6A2C06EAC97F228C5C66D1628C937CF|CwlA], [protein|50D7B97E4D3D41F74EF1942B85DE1DA4A33BEBB0|XlyA], [protein|A8AF827637B7208DFA101C9A2911BF9AB1AED08F|XlyB])
  • Structure

  • [PDB|3RDR] (N-terminal domain, aa 1 - 150, XlyA, 75% identity)
  • [PDB|1LBU] (C-terminal peptidoglycan-binding domain, aa 183 - 245, 48% identity)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|10515909], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|10515909], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|10515909]
  • view in new tab

    Biological materials


  • BKE25710 (Δ[gene|D5612882F1887BE342EF7072E71502382AB7289F|cwlH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTATCCCTCCCTATT, downstream forward: _UP4_TAAATGCAGGATTTAACGGA
  • BKK25710 (Δ[gene|D5612882F1887BE342EF7072E71502382AB7289F|cwlH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTATCCCTCCCTATT, downstream forward: _UP4_TAAATGCAGGATTTAACGGA
  • References

  • 10945275,10515909